FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640441_at:

>probe:Drosophila_2:1640441_at:1:723; Interrogation_Position=5874; Antisense; TTGCGCAACGGCTTCAGATGTCCGA
>probe:Drosophila_2:1640441_at:686:425; Interrogation_Position=5897; Antisense; GAGAGATCGATTCTCTCCCGACTGG
>probe:Drosophila_2:1640441_at:90:561; Interrogation_Position=5933; Antisense; GGAAATGCCTCCAATGCAGCTCAAT
>probe:Drosophila_2:1640441_at:34:727; Interrogation_Position=5957; Antisense; TTGATGGCACAATTCCCGGCTGGAT
>probe:Drosophila_2:1640441_at:220:191; Interrogation_Position=5992; Antisense; AACATTGCCAGCATTCACGAGCGGA
>probe:Drosophila_2:1640441_at:202:191; Interrogation_Position=6026; Antisense; AACTTTGCCAACTTTCGGCCACAGT
>probe:Drosophila_2:1640441_at:499:505; Interrogation_Position=6056; Antisense; GTGCCCGGCCAGCTATCGAATAATT
>probe:Drosophila_2:1640441_at:13:241; Interrogation_Position=6074; Antisense; AATAATTCCGGCGTCTAGGCATCTC
>probe:Drosophila_2:1640441_at:155:645; Interrogation_Position=6087; Antisense; TCTAGGCATCTCCTCAATATCTATG
>probe:Drosophila_2:1640441_at:662:307; Interrogation_Position=6199; Antisense; CCACGTCGCGTTCACACAAATAATT
>probe:Drosophila_2:1640441_at:699:175; Interrogation_Position=6230; Antisense; AAACGTTTGACACTTGGCGAATGGC
>probe:Drosophila_2:1640441_at:629:573; Interrogation_Position=6252; Antisense; GGCGAGTTCGGTGTTTCCAGGCTTC
>probe:Drosophila_2:1640441_at:574:451; Interrogation_Position=6296; Antisense; GATCGGATCTCAGCAGAGCACGACT
>probe:Drosophila_2:1640441_at:146:405; Interrogation_Position=6317; Antisense; GACTCGCGGTCAGTTCACATACGAC

Paste this into a BLAST search page for me
TTGCGCAACGGCTTCAGATGTCCGAGAGAGATCGATTCTCTCCCGACTGGGGAAATGCCTCCAATGCAGCTCAATTTGATGGCACAATTCCCGGCTGGATAACATTGCCAGCATTCACGAGCGGAAACTTTGCCAACTTTCGGCCACAGTGTGCCCGGCCAGCTATCGAATAATTAATAATTCCGGCGTCTAGGCATCTCTCTAGGCATCTCCTCAATATCTATGCCACGTCGCGTTCACACAAATAATTAAACGTTTGACACTTGGCGAATGGCGGCGAGTTCGGTGTTTCCAGGCTTCGATCGGATCTCAGCAGAGCACGACTGACTCGCGGTCAGTTCACATACGAC

Full Affymetrix probeset data:

Annotations for 1640441_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720