Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640442_at:

>probe:Drosophila_2:1640442_at:592:249; Interrogation_Position=15266; Antisense; CAACTCGTTGTTCAATGGCCTCCTG
>probe:Drosophila_2:1640442_at:354:729; Interrogation_Position=15309; Antisense; TTGGCGCCGGCGACATGCAAACAGT
>probe:Drosophila_2:1640442_at:54:55; Interrogation_Position=15323; Antisense; ATGCAAACAGTTGGCCAGCTGGCTG
>probe:Drosophila_2:1640442_at:663:569; Interrogation_Position=15358; Antisense; GGCTTCGGGCCGTGCAATACAAATA
>probe:Drosophila_2:1640442_at:143:595; Interrogation_Position=15412; Antisense; TGTGGCTGTCGGGACTGCATATACC
>probe:Drosophila_2:1640442_at:473:101; Interrogation_Position=15439; Antisense; AGAGTTATCTCACGGCCCTGGTGCA
>probe:Drosophila_2:1640442_at:148:705; Interrogation_Position=15510; Antisense; TTCACCTACGTAACCAAGTTTGCGG
>probe:Drosophila_2:1640442_at:654:305; Interrogation_Position=15572; Antisense; CCTGGTGCACGGTCTGTACATCGAG
>probe:Drosophila_2:1640442_at:548:691; Interrogation_Position=15606; Antisense; TTTGACTTGGCCACTAATCAGCTGG
>probe:Drosophila_2:1640442_at:433:71; Interrogation_Position=15691; Antisense; AGGCGCACCGTCTCAAGCTGCAGAA
>probe:Drosophila_2:1640442_at:247:483; Interrogation_Position=15732; Antisense; GTATACACGACATCGCTGCGCAGGA
>probe:Drosophila_2:1640442_at:320:503; Interrogation_Position=15768; Antisense; GTGGGCCTGGTCTTTGAGGCTAATT
>probe:Drosophila_2:1640442_at:383:21; Interrogation_Position=15790; Antisense; ATTTGGCCACTTCGGAGGATCTGAG
>probe:Drosophila_2:1640442_at:342:431; Interrogation_Position=15812; Antisense; GAGTCACTGGATTCTGCAGGGCGTC

Paste this into a BLAST search page for me
CAACTCGTTGTTCAATGGCCTCCTGTTGGCGCCGGCGACATGCAAACAGTATGCAAACAGTTGGCCAGCTGGCTGGGCTTCGGGCCGTGCAATACAAATATGTGGCTGTCGGGACTGCATATACCAGAGTTATCTCACGGCCCTGGTGCATTCACCTACGTAACCAAGTTTGCGGCCTGGTGCACGGTCTGTACATCGAGTTTGACTTGGCCACTAATCAGCTGGAGGCGCACCGTCTCAAGCTGCAGAAGTATACACGACATCGCTGCGCAGGAGTGGGCCTGGTCTTTGAGGCTAATTATTTGGCCACTTCGGAGGATCTGAGGAGTCACTGGATTCTGCAGGGCGTC

Full Affymetrix probeset data:

Annotations for 1640442_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime