Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640445_at:

>probe:Drosophila_2:1640445_at:661:35; Interrogation_Position=1223; Antisense; ATCAGTTTATGTTTGCGTCCACGGA
>probe:Drosophila_2:1640445_at:306:695; Interrogation_Position=1235; Antisense; TTGCGTCCACGGATGGTTACTTCCT
>probe:Drosophila_2:1640445_at:175:709; Interrogation_Position=1251; Antisense; TTACTTCCTCGCCTAGTTGATAATT
>probe:Drosophila_2:1640445_at:686:623; Interrogation_Position=1296; Antisense; TCGAAACCGTTTCATTTTTGCCAGT
>probe:Drosophila_2:1640445_at:295:701; Interrogation_Position=1335; Antisense; TTTTATTCATCGAACCGCACAGTGC
>probe:Drosophila_2:1640445_at:168:267; Interrogation_Position=1354; Antisense; CAGTGCCATGCTTTAAGGCGTCTGG
>probe:Drosophila_2:1640445_at:564:317; Interrogation_Position=1378; Antisense; GCCGGGTGCTGAACGTTTGAGAACT
>probe:Drosophila_2:1640445_at:337:423; Interrogation_Position=1396; Antisense; GAGAACTGCCCCAAACTATTTACAA
>probe:Drosophila_2:1640445_at:162:689; Interrogation_Position=1412; Antisense; TATTTACAACCTTCTGTCACTGTTT
>probe:Drosophila_2:1640445_at:191:275; Interrogation_Position=1422; Antisense; CTTCTGTCACTGTTTACACACTACT
>probe:Drosophila_2:1640445_at:724:171; Interrogation_Position=1484; Antisense; AAAGTTCTTCAATTTCTGATCGTCA
>probe:Drosophila_2:1640445_at:57:597; Interrogation_Position=1516; Antisense; TGTGTAATGACAGGCATGTCGCCAA
>probe:Drosophila_2:1640445_at:276:569; Interrogation_Position=1528; Antisense; GGCATGTCGCCAAACTAAACTGAGA
>probe:Drosophila_2:1640445_at:42:689; Interrogation_Position=1643; Antisense; TATATATTTGTTCTTCTGAGTGGGT

Paste this into a BLAST search page for me
ATCAGTTTATGTTTGCGTCCACGGATTGCGTCCACGGATGGTTACTTCCTTTACTTCCTCGCCTAGTTGATAATTTCGAAACCGTTTCATTTTTGCCAGTTTTTATTCATCGAACCGCACAGTGCCAGTGCCATGCTTTAAGGCGTCTGGGCCGGGTGCTGAACGTTTGAGAACTGAGAACTGCCCCAAACTATTTACAATATTTACAACCTTCTGTCACTGTTTCTTCTGTCACTGTTTACACACTACTAAAGTTCTTCAATTTCTGATCGTCATGTGTAATGACAGGCATGTCGCCAAGGCATGTCGCCAAACTAAACTGAGATATATATTTGTTCTTCTGAGTGGGT

Full Affymetrix probeset data:

Annotations for 1640445_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime