Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640446_s_at:

>probe:Drosophila_2:1640446_s_at:511:663; Interrogation_Position=112; Antisense; TAAATTGGTGTACCTGCGTTGCGTG
>probe:Drosophila_2:1640446_s_at:645:329; Interrogation_Position=138; Antisense; GCGGAGAAGTCGGTGCCACATCCTC
>probe:Drosophila_2:1640446_s_at:278:535; Interrogation_Position=188; Antisense; GGTCTGTCGCCCAAGAAAATCGGTG
>probe:Drosophila_2:1640446_s_at:351:311; Interrogation_Position=227; Antisense; GCCACCTCCGACTGGAAGGGTCTGA
>probe:Drosophila_2:1640446_s_at:236:223; Interrogation_Position=242; Antisense; AAGGGTCTGAAGATCACCGTCTGCC
>probe:Drosophila_2:1640446_s_at:293:307; Interrogation_Position=315; Antisense; CCTCGCTGATCATCAAGGCTCTGAA
>probe:Drosophila_2:1640446_s_at:419:347; Interrogation_Position=379; Antisense; GCACAGTGGAAACATTGGCTTCGAA
>probe:Drosophila_2:1640446_s_at:327:569; Interrogation_Position=395; Antisense; GGCTTCGAAGACATTCTGGCCATCG
>probe:Drosophila_2:1640446_s_at:164:359; Interrogation_Position=468; Antisense; GCAAGGAAGTTCTGGGAACCGCCCA
>probe:Drosophila_2:1640446_s_at:386:499; Interrogation_Position=497; Antisense; GTCGGCTGCACCGTTGACGGAAAGC
>probe:Drosophila_2:1640446_s_at:230:561; Interrogation_Position=515; Antisense; GGAAAGCACCCTCACGATGTTATTG
>probe:Drosophila_2:1640446_s_at:483:611; Interrogation_Position=538; Antisense; TGACGAACTGAACGAGGGCTCCATT
>probe:Drosophila_2:1640446_s_at:138:283; Interrogation_Position=556; Antisense; CTCCATTGAAGTCCCCGCGGAATAA
>probe:Drosophila_2:1640446_s_at:611:405; Interrogation_Position=59; Antisense; GACTGTTCAAGCCAAGATACCGCTA

Paste this into a BLAST search page for me
TAAATTGGTGTACCTGCGTTGCGTGGCGGAGAAGTCGGTGCCACATCCTCGGTCTGTCGCCCAAGAAAATCGGTGGCCACCTCCGACTGGAAGGGTCTGAAAGGGTCTGAAGATCACCGTCTGCCCCTCGCTGATCATCAAGGCTCTGAAGCACAGTGGAAACATTGGCTTCGAAGGCTTCGAAGACATTCTGGCCATCGGCAAGGAAGTTCTGGGAACCGCCCAGTCGGCTGCACCGTTGACGGAAAGCGGAAAGCACCCTCACGATGTTATTGTGACGAACTGAACGAGGGCTCCATTCTCCATTGAAGTCCCCGCGGAATAAGACTGTTCAAGCCAAGATACCGCTA

Full Affymetrix probeset data:

Annotations for 1640446_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime