Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640449_s_at:

>probe:Drosophila_2:1640449_s_at:276:625; Interrogation_Position=150; Antisense; TGCCCAAGTGGTGTCCTGTTCGCAT
>probe:Drosophila_2:1640449_s_at:30:505; Interrogation_Position=162; Antisense; GTCCTGTTCGCATTGTGAGTGAATC
>probe:Drosophila_2:1640449_s_at:241:85; Interrogation_Position=179; Antisense; AGTGAATCACCGATGGCCGCGGGCA
>probe:Drosophila_2:1640449_s_at:432:71; Interrogation_Position=203; Antisense; AGGCTGAACTGCACCATAGTGGGAT
>probe:Drosophila_2:1640449_s_at:413:307; Interrogation_Position=216; Antisense; CCATAGTGGGATGCTGGTTCTGGCT
>probe:Drosophila_2:1640449_s_at:486:641; Interrogation_Position=234; Antisense; TCTGGCTGTCGATGCAAGTGGATGT
>probe:Drosophila_2:1640449_s_at:51:55; Interrogation_Position=281; Antisense; ATGCAAATGCAATCGGCGCAGTTCG
>probe:Drosophila_2:1640449_s_at:182:237; Interrogation_Position=291; Antisense; AATCGGCGCAGTTCGGCTGCAATAA
>probe:Drosophila_2:1640449_s_at:520:529; Interrogation_Position=325; Antisense; GGGATACTAACTGCCAAAGCCAGTG
>probe:Drosophila_2:1640449_s_at:516:465; Interrogation_Position=415; Antisense; GTTGGAGTTCAGAGTACTTGGTACT
>probe:Drosophila_2:1640449_s_at:259:487; Interrogation_Position=490; Antisense; GTAGCAGTCACACAGGCACACACGA
>probe:Drosophila_2:1640449_s_at:442:385; Interrogation_Position=513; Antisense; GAACATACTCACAACTCCAGTGCAT
>probe:Drosophila_2:1640449_s_at:723:29; Interrogation_Position=536; Antisense; ATAAAACTCCAAACTGCGTTCGCCT
>probe:Drosophila_2:1640449_s_at:49:421; Interrogation_Position=663; Antisense; GAGCAAGGAAGTGGTTTTTCCACCG

Paste this into a BLAST search page for me
TGCCCAAGTGGTGTCCTGTTCGCATGTCCTGTTCGCATTGTGAGTGAATCAGTGAATCACCGATGGCCGCGGGCAAGGCTGAACTGCACCATAGTGGGATCCATAGTGGGATGCTGGTTCTGGCTTCTGGCTGTCGATGCAAGTGGATGTATGCAAATGCAATCGGCGCAGTTCGAATCGGCGCAGTTCGGCTGCAATAAGGGATACTAACTGCCAAAGCCAGTGGTTGGAGTTCAGAGTACTTGGTACTGTAGCAGTCACACAGGCACACACGAGAACATACTCACAACTCCAGTGCATATAAAACTCCAAACTGCGTTCGCCTGAGCAAGGAAGTGGTTTTTCCACCG

Full Affymetrix probeset data:

Annotations for 1640449_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime