FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640450_at:

>probe:Drosophila_2:1640450_at:644:587; Interrogation_Position=279; Antisense; TGATCACTTCCCTGGTGGTTATAGT
>probe:Drosophila_2:1640450_at:6:709; Interrogation_Position=309; Antisense; TTACTGCTGATAAACGGGTGCGTCT
>probe:Drosophila_2:1640450_at:559:145; Interrogation_Position=373; Antisense; ACTAATAGTGGTCTTCTCTCTGGTG
>probe:Drosophila_2:1640450_at:103:333; Interrogation_Position=405; Antisense; GCTGCAATGAGGATCTGCGTCGTCA
>probe:Drosophila_2:1640450_at:516:125; Interrogation_Position=496; Antisense; AGCCTGTCGTTATGCCCCAATGGAG
>probe:Drosophila_2:1640450_at:631:237; Interrogation_Position=538; Antisense; AATCACGGCGTCAGTTTGCCTTGGA
>probe:Drosophila_2:1640450_at:311:701; Interrogation_Position=571; Antisense; TTTTGCTCTGCAGACGCGTTACGAC
>probe:Drosophila_2:1640450_at:306:325; Interrogation_Position=586; Antisense; GCGTTACGACTTTACCGTCATGGGT
>probe:Drosophila_2:1640450_at:709:625; Interrogation_Position=626; Antisense; TGCCTGATAATACTGCTCTTCTTTG
>probe:Drosophila_2:1640450_at:458:585; Interrogation_Position=649; Antisense; TGGAATTGTGACCATCTTCGTGGGC
>probe:Drosophila_2:1640450_at:340:717; Interrogation_Position=665; Antisense; TTCGTGGGCGGACATATGGTCACCA
>probe:Drosophila_2:1640450_at:64:23; Interrogation_Position=692; Antisense; ATATATGCCTCATTGAGCGCTCTGC
>probe:Drosophila_2:1640450_at:394:25; Interrogation_Position=768; Antisense; ATAGGTACTCCATTAGTCCCGAGGA
>probe:Drosophila_2:1640450_at:334:437; Interrogation_Position=788; Antisense; GAGGAGTACATATTCGCTGCCCTAA

Paste this into a BLAST search page for me
TGATCACTTCCCTGGTGGTTATAGTTTACTGCTGATAAACGGGTGCGTCTACTAATAGTGGTCTTCTCTCTGGTGGCTGCAATGAGGATCTGCGTCGTCAAGCCTGTCGTTATGCCCCAATGGAGAATCACGGCGTCAGTTTGCCTTGGATTTTGCTCTGCAGACGCGTTACGACGCGTTACGACTTTACCGTCATGGGTTGCCTGATAATACTGCTCTTCTTTGTGGAATTGTGACCATCTTCGTGGGCTTCGTGGGCGGACATATGGTCACCAATATATGCCTCATTGAGCGCTCTGCATAGGTACTCCATTAGTCCCGAGGAGAGGAGTACATATTCGCTGCCCTAA

Full Affymetrix probeset data:

Annotations for 1640450_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720