FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640451_at:

>probe:Drosophila_2:1640451_at:174:41; Interrogation_Position=525; Antisense; ATCGGCGTATCCAATTTCAACTCGG
>probe:Drosophila_2:1640451_at:698:145; Interrogation_Position=544; Antisense; ACTCGGAACAGTTGACTCGCTTGCT
>probe:Drosophila_2:1640451_at:242:239; Interrogation_Position=597; Antisense; AATCAGATCGAATGTCATCCCGCGT
>probe:Drosophila_2:1640451_at:494:59; Interrogation_Position=608; Antisense; ATGTCATCCCGCGTTGAACCAGAAG
>probe:Drosophila_2:1640451_at:629:55; Interrogation_Position=658; Antisense; ATGACATTGTAGTGACCGCCTACTG
>probe:Drosophila_2:1640451_at:616:525; Interrogation_Position=689; Antisense; GGGCAGACCCAATCCAGCAGAAAAG
>probe:Drosophila_2:1640451_at:675:211; Interrogation_Position=711; Antisense; AAGACGCCCAACTACATCTATGATG
>probe:Drosophila_2:1640451_at:539:217; Interrogation_Position=759; Antisense; AAGTACAAGAAGTCCACCGCCCAAG
>probe:Drosophila_2:1640451_at:647:465; Interrogation_Position=806; Antisense; GATTGGAACCATCCCATTGCCAAAG
>probe:Drosophila_2:1640451_at:519:3; Interrogation_Position=821; Antisense; ATTGCCAAAGTCCTCAAATCCCAAG
>probe:Drosophila_2:1640451_at:531:97; Interrogation_Position=865; Antisense; AGATCTTCGACTTCCAGCTGGATGC
>probe:Drosophila_2:1640451_at:118:335; Interrogation_Position=888; Antisense; GCTGAGGATCATGCCATTCTGGATT
>probe:Drosophila_2:1640451_at:483:11; Interrogation_Position=903; Antisense; ATTCTGGATTCCTACAACACCGGAG
>probe:Drosophila_2:1640451_at:591:129; Interrogation_Position=921; Antisense; ACCGGAGAACGTCTGATTCCCATGA

Paste this into a BLAST search page for me
ATCGGCGTATCCAATTTCAACTCGGACTCGGAACAGTTGACTCGCTTGCTAATCAGATCGAATGTCATCCCGCGTATGTCATCCCGCGTTGAACCAGAAGATGACATTGTAGTGACCGCCTACTGGGGCAGACCCAATCCAGCAGAAAAGAAGACGCCCAACTACATCTATGATGAAGTACAAGAAGTCCACCGCCCAAGGATTGGAACCATCCCATTGCCAAAGATTGCCAAAGTCCTCAAATCCCAAGAGATCTTCGACTTCCAGCTGGATGCGCTGAGGATCATGCCATTCTGGATTATTCTGGATTCCTACAACACCGGAGACCGGAGAACGTCTGATTCCCATGA

Full Affymetrix probeset data:

Annotations for 1640451_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720