FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640452_at:

>probe:Drosophila_2:1640452_at:473:199; Interrogation_Position=1097; Antisense; AACGACGTGTTATAGAGGCTTCTGA
>probe:Drosophila_2:1640452_at:131:139; Interrogation_Position=1134; Antisense; ACGATTGTGATTTCCTGTCATGAAC
>probe:Drosophila_2:1640452_at:725:575; Interrogation_Position=628; Antisense; GGCGAACGATTCCTATGCTGGTGAT
>probe:Drosophila_2:1640452_at:106:509; Interrogation_Position=648; Antisense; GTGATGTGTGGCAAGTTCCCTGTAT
>probe:Drosophila_2:1640452_at:62:437; Interrogation_Position=676; Antisense; GAGGCAAATCTTCAGCTCGGCCGGT
>probe:Drosophila_2:1640452_at:438:83; Interrogation_Position=704; Antisense; AGTGGCCCCAATCGCGAATACCTAT
>probe:Drosophila_2:1640452_at:119:315; Interrogation_Position=743; Antisense; GCCATGGATCAGCTCTTTCCGGGAG
>probe:Drosophila_2:1640452_at:415:719; Interrogation_Position=759; Antisense; TTCCGGGAGCTGTAGACGAGCATCT
>probe:Drosophila_2:1640452_at:44:475; Interrogation_Position=810; Antisense; GTTACATTGTCGAGGATGAGCCCCA
>probe:Drosophila_2:1640452_at:643:443; Interrogation_Position=824; Antisense; GATGAGCCCCAGTTAATACGCCATG
>probe:Drosophila_2:1640452_at:670:323; Interrogation_Position=848; Antisense; GCGCTGTTGCATGAGATTTCCGGTA
>probe:Drosophila_2:1640452_at:144:189; Interrogation_Position=885; Antisense; AACAGCTAGCGGAGCAGGCACACCA
>probe:Drosophila_2:1640452_at:571:61; Interrogation_Position=931; Antisense; ATGTCAGAAACCTGGCGGCCGCGAG
>probe:Drosophila_2:1640452_at:287:519; Interrogation_Position=955; Antisense; GTGGTTGATCTACGCTGCACTGCAA

Paste this into a BLAST search page for me
AACGACGTGTTATAGAGGCTTCTGAACGATTGTGATTTCCTGTCATGAACGGCGAACGATTCCTATGCTGGTGATGTGATGTGTGGCAAGTTCCCTGTATGAGGCAAATCTTCAGCTCGGCCGGTAGTGGCCCCAATCGCGAATACCTATGCCATGGATCAGCTCTTTCCGGGAGTTCCGGGAGCTGTAGACGAGCATCTGTTACATTGTCGAGGATGAGCCCCAGATGAGCCCCAGTTAATACGCCATGGCGCTGTTGCATGAGATTTCCGGTAAACAGCTAGCGGAGCAGGCACACCAATGTCAGAAACCTGGCGGCCGCGAGGTGGTTGATCTACGCTGCACTGCAA

Full Affymetrix probeset data:

Annotations for 1640452_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720