Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640454_at:

>probe:Drosophila_2:1640454_at:466:421; Interrogation_Position=1421; Antisense; GAGAATGCCCAGAGCTACGTCCGGT
>probe:Drosophila_2:1640454_at:243:137; Interrogation_Position=1437; Antisense; ACGTCCGGTTTCTGGAGAGCGAGCT
>probe:Drosophila_2:1640454_at:618:393; Interrogation_Position=1491; Antisense; GAAAGGGCCGTGAGTCCATCATCAA
>probe:Drosophila_2:1640454_at:72:223; Interrogation_Position=1537; Antisense; AAGGGTGCCGACGACGTACTTATGC
>probe:Drosophila_2:1640454_at:323:489; Interrogation_Position=1552; Antisense; GTACTTATGCCTACCAGTTCGTGTA
>probe:Drosophila_2:1640454_at:271:513; Interrogation_Position=1572; Antisense; GTGTATCTGAGACGGAAACGCTTTA
>probe:Drosophila_2:1640454_at:115:201; Interrogation_Position=1588; Antisense; AACGCTTTAGTAGAGCCCATTGGGC
>probe:Drosophila_2:1640454_at:171:301; Interrogation_Position=1603; Antisense; CCCATTGGGCAGAAACGGCGCTTAA
>probe:Drosophila_2:1640454_at:240:277; Interrogation_Position=1651; Antisense; CTAACCACCCACAAATACAACTAAT
>probe:Drosophila_2:1640454_at:260:695; Interrogation_Position=1677; Antisense; TTTCGACTATCTACAACATTTGGAC
>probe:Drosophila_2:1640454_at:591:245; Interrogation_Position=1758; Antisense; AATTCATTTGAAGCGGTGCCGTCCG
>probe:Drosophila_2:1640454_at:7:191; Interrogation_Position=1811; Antisense; AACTTCTTGTTTGATGAGGACGTAC
>probe:Drosophila_2:1640454_at:367:453; Interrogation_Position=1847; Antisense; GATCATCAGGTGCAGTTTCAGATTT
>probe:Drosophila_2:1640454_at:708:187; Interrogation_Position=1944; Antisense; AACAGTGTGCTCTGACTTGTGTAAT

Paste this into a BLAST search page for me
GAGAATGCCCAGAGCTACGTCCGGTACGTCCGGTTTCTGGAGAGCGAGCTGAAAGGGCCGTGAGTCCATCATCAAAAGGGTGCCGACGACGTACTTATGCGTACTTATGCCTACCAGTTCGTGTAGTGTATCTGAGACGGAAACGCTTTAAACGCTTTAGTAGAGCCCATTGGGCCCCATTGGGCAGAAACGGCGCTTAACTAACCACCCACAAATACAACTAATTTTCGACTATCTACAACATTTGGACAATTCATTTGAAGCGGTGCCGTCCGAACTTCTTGTTTGATGAGGACGTACGATCATCAGGTGCAGTTTCAGATTTAACAGTGTGCTCTGACTTGTGTAAT

Full Affymetrix probeset data:

Annotations for 1640454_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime