Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640456_at:

>probe:Drosophila_2:1640456_at:194:263; Interrogation_Position=2746; Antisense; CAGCGTCACCGCAAAAGGTTCGGGA
>probe:Drosophila_2:1640456_at:229:537; Interrogation_Position=2828; Antisense; GGTCAGTCCACGAAAGGCAAGTCCC
>probe:Drosophila_2:1640456_at:353:293; Interrogation_Position=2853; Antisense; CGAAAGCCGCGTGTGGGTCGACCAC
>probe:Drosophila_2:1640456_at:276:533; Interrogation_Position=2879; Antisense; GGTGTCCAACGCCAAGCCTAATGTG
>probe:Drosophila_2:1640456_at:147:281; Interrogation_Position=2896; Antisense; CTAATGTGGAAATCAGCTGCTGCGT
>probe:Drosophila_2:1640456_at:477:517; Interrogation_Position=2919; Antisense; GTGTGCAGCCAGACGGGCAAGTCCA
>probe:Drosophila_2:1640456_at:524:203; Interrogation_Position=2943; Antisense; AACCAGGTGGTGACCTGCGACGAGT
>probe:Drosophila_2:1640456_at:367:109; Interrogation_Position=3010; Antisense; AGAAGTCGCCCAAGATTCGCGGCTA
>probe:Drosophila_2:1640456_at:326:407; Interrogation_Position=3051; Antisense; GACTGTGATCCCACGGACGAGGATG
>probe:Drosophila_2:1640456_at:105:557; Interrogation_Position=3065; Antisense; GGACGAGGATGCACTGCCCAAGAAA
>probe:Drosophila_2:1640456_at:565:273; Interrogation_Position=3125; Antisense; CATTAATATCATTAGGTCCGTGCGA
>probe:Drosophila_2:1640456_at:729:479; Interrogation_Position=3139; Antisense; GGTCCGTGCGATATTTACAAAACTA
>probe:Drosophila_2:1640456_at:573:161; Interrogation_Position=3225; Antisense; AAATTGTAATTTGTCACTCGCTGAA
>probe:Drosophila_2:1640456_at:468:495; Interrogation_Position=3237; Antisense; GTCACTCGCTGAATTGTTCGGCTCA

Paste this into a BLAST search page for me
CAGCGTCACCGCAAAAGGTTCGGGAGGTCAGTCCACGAAAGGCAAGTCCCCGAAAGCCGCGTGTGGGTCGACCACGGTGTCCAACGCCAAGCCTAATGTGCTAATGTGGAAATCAGCTGCTGCGTGTGTGCAGCCAGACGGGCAAGTCCAAACCAGGTGGTGACCTGCGACGAGTAGAAGTCGCCCAAGATTCGCGGCTAGACTGTGATCCCACGGACGAGGATGGGACGAGGATGCACTGCCCAAGAAACATTAATATCATTAGGTCCGTGCGAGGTCCGTGCGATATTTACAAAACTAAAATTGTAATTTGTCACTCGCTGAAGTCACTCGCTGAATTGTTCGGCTCA

Full Affymetrix probeset data:

Annotations for 1640456_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime