FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640458_at:

>probe:Drosophila_2:1640458_at:683:233; Interrogation_Position=116; Antisense; AATCCGCTTCTTCAGTGCAATGCAT
>probe:Drosophila_2:1640458_at:432:553; Interrogation_Position=206; Antisense; GGAGCAGTCCTAGCTACTGTCAGAA
>probe:Drosophila_2:1640458_at:331:541; Interrogation_Position=22; Antisense; GGTTACCATACTGTTCACTATCTTT
>probe:Drosophila_2:1640458_at:4:339; Interrogation_Position=247; Antisense; GCTAATGCTTCACTACGTCAACAGG
>probe:Drosophila_2:1640458_at:309:265; Interrogation_Position=292; Antisense; CAGAACCTTTTGGTTGGGCGCCACA
>probe:Drosophila_2:1640458_at:444:157; Interrogation_Position=314; Antisense; ACAAACCTGGTGGATCGGAGCTATT
>probe:Drosophila_2:1640458_at:656:451; Interrogation_Position=326; Antisense; GATCGGAGCTATTTCTGGACCTGGA
>probe:Drosophila_2:1640458_at:373:585; Interrogation_Position=341; Antisense; TGGACCTGGATGAGCACTGGCATTC
>probe:Drosophila_2:1640458_at:134:473; Interrogation_Position=368; Antisense; GTTACCTACGCACAATGGAGCCGGA
>probe:Drosophila_2:1640458_at:77:149; Interrogation_Position=38; Antisense; ACTATCTTTAGCTTACCTTTCTTGG
>probe:Drosophila_2:1640458_at:205:425; Interrogation_Position=391; Antisense; GAGAGAGCCCAAGTCTGATCGAACA
>probe:Drosophila_2:1640458_at:90:135; Interrogation_Position=423; Antisense; ACGCCTGCCTGGTCTTGGGAACAGA
>probe:Drosophila_2:1640458_at:399:397; Interrogation_Position=446; Antisense; GACAATCTCTGGCATAGTGAACCCT
>probe:Drosophila_2:1640458_at:617:613; Interrogation_Position=463; Antisense; TGAACCCTGCCAACGGAAACACAAT

Paste this into a BLAST search page for me
AATCCGCTTCTTCAGTGCAATGCATGGAGCAGTCCTAGCTACTGTCAGAAGGTTACCATACTGTTCACTATCTTTGCTAATGCTTCACTACGTCAACAGGCAGAACCTTTTGGTTGGGCGCCACAACAAACCTGGTGGATCGGAGCTATTGATCGGAGCTATTTCTGGACCTGGATGGACCTGGATGAGCACTGGCATTCGTTACCTACGCACAATGGAGCCGGAACTATCTTTAGCTTACCTTTCTTGGGAGAGAGCCCAAGTCTGATCGAACAACGCCTGCCTGGTCTTGGGAACAGAGACAATCTCTGGCATAGTGAACCCTTGAACCCTGCCAACGGAAACACAAT

Full Affymetrix probeset data:

Annotations for 1640458_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720