Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640460_at:

>probe:Drosophila_2:1640460_at:628:103; Interrogation_Position=1019; Antisense; AGACCATTCGGATCTACAATGCCCA
>probe:Drosophila_2:1640460_at:302:89; Interrogation_Position=1048; Antisense; AGTCACTCGCGGGATATTTACCACA
>probe:Drosophila_2:1640460_at:552:581; Interrogation_Position=1100; Antisense; TGGCCTGGTCCCTCGATAATCGATA
>probe:Drosophila_2:1640460_at:546:455; Interrogation_Position=1114; Antisense; GATAATCGATACGTTTTCTCCGGCT
>probe:Drosophila_2:1640460_at:464:701; Interrogation_Position=1127; Antisense; TTTTCTCCGGCTCCGACGAAATGAA
>probe:Drosophila_2:1640460_at:590:221; Interrogation_Position=1165; Antisense; AAGGCGAATGCCTCCGAAAAGCTGG
>probe:Drosophila_2:1640460_at:265:389; Interrogation_Position=1180; Antisense; GAAAAGCTGGGCGTCATCCGTCCAC
>probe:Drosophila_2:1640460_at:172:309; Interrogation_Position=1201; Antisense; CCACGTGAGCGCGTCAATTTCAATT
>probe:Drosophila_2:1640460_at:547:183; Interrogation_Position=1244; Antisense; AAAAGTATGCCGCTCATCCGCAGAT
>probe:Drosophila_2:1640460_at:93:223; Interrogation_Position=1396; Antisense; AAGGTGCCCTACGTCAGCGAGAAAA
>probe:Drosophila_2:1640460_at:199:615; Interrogation_Position=920; Antisense; TGCAAACGCCGCTGAAGGTTCACTT
>probe:Drosophila_2:1640460_at:153:79; Interrogation_Position=935; Antisense; AGGTTCACTTTGACCATGTTTCCGC
>probe:Drosophila_2:1640460_at:52:61; Interrogation_Position=950; Antisense; ATGTTTCCGCTGTCACCGATGTTGA
>probe:Drosophila_2:1640460_at:399:361; Interrogation_Position=989; Antisense; GCAAGGAATTCGTCTCGGCCAGCTA

Paste this into a BLAST search page for me
AGACCATTCGGATCTACAATGCCCAAGTCACTCGCGGGATATTTACCACATGGCCTGGTCCCTCGATAATCGATAGATAATCGATACGTTTTCTCCGGCTTTTTCTCCGGCTCCGACGAAATGAAAAGGCGAATGCCTCCGAAAAGCTGGGAAAAGCTGGGCGTCATCCGTCCACCCACGTGAGCGCGTCAATTTCAATTAAAAGTATGCCGCTCATCCGCAGATAAGGTGCCCTACGTCAGCGAGAAAATGCAAACGCCGCTGAAGGTTCACTTAGGTTCACTTTGACCATGTTTCCGCATGTTTCCGCTGTCACCGATGTTGAGCAAGGAATTCGTCTCGGCCAGCTA

Full Affymetrix probeset data:

Annotations for 1640460_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime