Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640461_at:

>probe:Drosophila_2:1640461_at:102:131; Interrogation_Position=1002; Antisense; ACCGTGTTCGACTGCCGGATGAAGG
>probe:Drosophila_2:1640461_at:704:229; Interrogation_Position=1091; Antisense; AATGCTGCGCCACGTGAAGATGGAC
>probe:Drosophila_2:1640461_at:539:397; Interrogation_Position=1113; Antisense; GACAAGCAGGCGGACCAAGTCGACT
>probe:Drosophila_2:1640461_at:20:323; Interrogation_Position=1138; Antisense; GCGCCATTCGCAAGGTCTACAAGGA
>probe:Drosophila_2:1640461_at:172:499; Interrogation_Position=1152; Antisense; GTCTACAAGGACACCGATATCCGCA
>probe:Drosophila_2:1640461_at:600:219; Interrogation_Position=1200; Antisense; AAGTGCTCAGAGTTCGTTAAGGCCG
>probe:Drosophila_2:1640461_at:282:657; Interrogation_Position=1217; Antisense; TAAGGCCGTGTGTGATTGCCTCTAA
>probe:Drosophila_2:1640461_at:160:465; Interrogation_Position=1230; Antisense; GATTGCCTCTAAGTTCTGCTCTTAA
>probe:Drosophila_2:1640461_at:542:53; Interrogation_Position=768; Antisense; ATGACGGACGGCAACTTCCTGGAGG
>probe:Drosophila_2:1640461_at:256:69; Interrogation_Position=805; Antisense; AGGCCGACAAGCACGTGGACGACGT
>probe:Drosophila_2:1640461_at:380:407; Interrogation_Position=825; Antisense; GACGTTTTGTTCGAGGAGCGCTACC
>probe:Drosophila_2:1640461_at:278:673; Interrogation_Position=846; Antisense; TACCTGGACACCTGCATTCTGAAGA
>probe:Drosophila_2:1640461_at:366:613; Interrogation_Position=877; Antisense; TGAAGCCCCACAAGTGCGACGTGAT
>probe:Drosophila_2:1640461_at:458:139; Interrogation_Position=895; Antisense; ACGTGATGGTCTCGTCCAGCATGTA

Paste this into a BLAST search page for me
ACCGTGTTCGACTGCCGGATGAAGGAATGCTGCGCCACGTGAAGATGGACGACAAGCAGGCGGACCAAGTCGACTGCGCCATTCGCAAGGTCTACAAGGAGTCTACAAGGACACCGATATCCGCAAAGTGCTCAGAGTTCGTTAAGGCCGTAAGGCCGTGTGTGATTGCCTCTAAGATTGCCTCTAAGTTCTGCTCTTAAATGACGGACGGCAACTTCCTGGAGGAGGCCGACAAGCACGTGGACGACGTGACGTTTTGTTCGAGGAGCGCTACCTACCTGGACACCTGCATTCTGAAGATGAAGCCCCACAAGTGCGACGTGATACGTGATGGTCTCGTCCAGCATGTA

Full Affymetrix probeset data:

Annotations for 1640461_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime