FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640462_at:

>probe:Drosophila_2:1640462_at:600:603; Interrogation_Position=522; Antisense; TGTTCGCCTACTCCTATCAGATGTA
>probe:Drosophila_2:1640462_at:49:667; Interrogation_Position=545; Antisense; TACATGGCTTTGATGTCCGGCGGAC
>probe:Drosophila_2:1640462_at:563:335; Interrogation_Position=683; Antisense; GCTGCCGATGGCTCTGTAGACAAAG
>probe:Drosophila_2:1640462_at:361:73; Interrogation_Position=738; Antisense; AGGTTACCATTTGCCCGCCGGGATG
>probe:Drosophila_2:1640462_at:176:513; Interrogation_Position=762; Antisense; GTGAGGCCACATATTTTCCTGAGAA
>probe:Drosophila_2:1640462_at:179:375; Interrogation_Position=784; Antisense; GAAGATCTCTGTCTTAAAGGCCAAA
>probe:Drosophila_2:1640462_at:23:227; Interrogation_Position=811; Antisense; AAGGCGCGTTTTCAACAATCACTAC
>probe:Drosophila_2:1640462_at:358:237; Interrogation_Position=827; Antisense; AATCACTACGGAGCTTTTGACGATG
>probe:Drosophila_2:1640462_at:24:295; Interrogation_Position=847; Antisense; CGATGATTTGCGTGCTGCTTTTATT
>probe:Drosophila_2:1640462_at:649:391; Interrogation_Position=875; Antisense; GAAAGTCGCAACGTATTTCGCTTAA
>probe:Drosophila_2:1640462_at:156:79; Interrogation_Position=925; Antisense; AGGTGTGAATCGTGCCAATCTTAGG
>probe:Drosophila_2:1640462_at:214:237; Interrogation_Position=941; Antisense; AATCTTAGGAAGCTGGCCCTCGCAC
>probe:Drosophila_2:1640462_at:7:301; Interrogation_Position=957; Antisense; CCCTCGCACTAATCTTTGTTTCAAG
>probe:Drosophila_2:1640462_at:581:521; Interrogation_Position=989; Antisense; GTGGCCGTGAAATTTGCTCTCAAGT

Paste this into a BLAST search page for me
TGTTCGCCTACTCCTATCAGATGTATACATGGCTTTGATGTCCGGCGGACGCTGCCGATGGCTCTGTAGACAAAGAGGTTACCATTTGCCCGCCGGGATGGTGAGGCCACATATTTTCCTGAGAAGAAGATCTCTGTCTTAAAGGCCAAAAAGGCGCGTTTTCAACAATCACTACAATCACTACGGAGCTTTTGACGATGCGATGATTTGCGTGCTGCTTTTATTGAAAGTCGCAACGTATTTCGCTTAAAGGTGTGAATCGTGCCAATCTTAGGAATCTTAGGAAGCTGGCCCTCGCACCCCTCGCACTAATCTTTGTTTCAAGGTGGCCGTGAAATTTGCTCTCAAGT

Full Affymetrix probeset data:

Annotations for 1640462_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720