FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640464_at:

>probe:Drosophila_2:1640464_at:594:633; Interrogation_Position=107; Antisense; TCGCCACTTTGAACACTGCCAGCTG
>probe:Drosophila_2:1640464_at:581:57; Interrogation_Position=13; Antisense; ATGATGCCCAGTCGCGTCAAACTGA
>probe:Drosophila_2:1640464_at:442:675; Interrogation_Position=153; Antisense; TAGACGAAAGCGAATCCTCACCCCT
>probe:Drosophila_2:1640464_at:224:89; Interrogation_Position=210; Antisense; AGTCTTGACCCTGTTGATCCTGGAC
>probe:Drosophila_2:1640464_at:672:493; Interrogation_Position=28; Antisense; GTCAAACTGAAACGCGGCACGGACG
>probe:Drosophila_2:1640464_at:330:421; Interrogation_Position=307; Antisense; GAGCAGCTCAACATCGGCCTGATCG
>probe:Drosophila_2:1640464_at:222:431; Interrogation_Position=358; Antisense; GAGTACCTGCGCAGCATCAACAACG
>probe:Drosophila_2:1640464_at:391:651; Interrogation_Position=374; Antisense; TCAACAACGCGGTCACAGGATTAAC
>probe:Drosophila_2:1640464_at:661:541; Interrogation_Position=391; Antisense; GGATTAACGAAGACGCGCGGCGCCA
>probe:Drosophila_2:1640464_at:497:225; Interrogation_Position=430; Antisense; AAGGACTACTCCTTCGAGCAGAAGA
>probe:Drosophila_2:1640464_at:523:591; Interrogation_Position=498; Antisense; TGAGTTTCCTACACAAAGCACCTTT
>probe:Drosophila_2:1640464_at:430:207; Interrogation_Position=513; Antisense; AAGCACCTTTTCTCCAATTATGTAG
>probe:Drosophila_2:1640464_at:568:321; Interrogation_Position=72; Antisense; GCCCATGCCTACCACAATGCGAAAG
>probe:Drosophila_2:1640464_at:19:391; Interrogation_Position=92; Antisense; GAAAGCATACGCCAATCGCCACTTT

Paste this into a BLAST search page for me
TCGCCACTTTGAACACTGCCAGCTGATGATGCCCAGTCGCGTCAAACTGATAGACGAAAGCGAATCCTCACCCCTAGTCTTGACCCTGTTGATCCTGGACGTCAAACTGAAACGCGGCACGGACGGAGCAGCTCAACATCGGCCTGATCGGAGTACCTGCGCAGCATCAACAACGTCAACAACGCGGTCACAGGATTAACGGATTAACGAAGACGCGCGGCGCCAAAGGACTACTCCTTCGAGCAGAAGATGAGTTTCCTACACAAAGCACCTTTAAGCACCTTTTCTCCAATTATGTAGGCCCATGCCTACCACAATGCGAAAGGAAAGCATACGCCAATCGCCACTTT

Full Affymetrix probeset data:

Annotations for 1640464_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720