Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640465_at:

>probe:Drosophila_2:1640465_at:496:389; Interrogation_Position=1700; Antisense; GAAACAGCTGCATTTTAGAAAACCC
>probe:Drosophila_2:1640465_at:438:633; Interrogation_Position=1764; Antisense; TCCCATACAGCTCGATTCTCAAAAA
>probe:Drosophila_2:1640465_at:286:721; Interrogation_Position=1790; Antisense; TTGTAAATACCCACGAAAAGCATCA
>probe:Drosophila_2:1640465_at:325:183; Interrogation_Position=1805; Antisense; AAAAGCATCAACACTTCTTCACTCC
>probe:Drosophila_2:1640465_at:555:627; Interrogation_Position=1827; Antisense; TCCACGGAATCTACACCTCTTTGTA
>probe:Drosophila_2:1640465_at:1:261; Interrogation_Position=1840; Antisense; CACCTCTTTGTAGTAGTGTCTAAAC
>probe:Drosophila_2:1640465_at:210:29; Interrogation_Position=1933; Antisense; ATACGCTATTATGATTCAGCTTTAG
>probe:Drosophila_2:1640465_at:464:633; Interrogation_Position=1948; Antisense; TCAGCTTTAGCACACCTAGACTATC
>probe:Drosophila_2:1640465_at:486:675; Interrogation_Position=1964; Antisense; TAGACTATCGAACCCTATTTCTCTC
>probe:Drosophila_2:1640465_at:478:17; Interrogation_Position=1980; Antisense; ATTTCTCTCTACCAGATCGTAAACG
>probe:Drosophila_2:1640465_at:400:483; Interrogation_Position=2042; Antisense; GTATCAACAAATTAATCACCGCATT
>probe:Drosophila_2:1640465_at:426:649; Interrogation_Position=2057; Antisense; TCACCGCATTATTCCATTGCAACAT
>probe:Drosophila_2:1640465_at:685:477; Interrogation_Position=2114; Antisense; GTTTAGCATTAAAGCATTCACACCT
>probe:Drosophila_2:1640465_at:335:13; Interrogation_Position=2129; Antisense; ATTCACACCTAATCATGCACATAAC

Paste this into a BLAST search page for me
GAAACAGCTGCATTTTAGAAAACCCTCCCATACAGCTCGATTCTCAAAAATTGTAAATACCCACGAAAAGCATCAAAAAGCATCAACACTTCTTCACTCCTCCACGGAATCTACACCTCTTTGTACACCTCTTTGTAGTAGTGTCTAAACATACGCTATTATGATTCAGCTTTAGTCAGCTTTAGCACACCTAGACTATCTAGACTATCGAACCCTATTTCTCTCATTTCTCTCTACCAGATCGTAAACGGTATCAACAAATTAATCACCGCATTTCACCGCATTATTCCATTGCAACATGTTTAGCATTAAAGCATTCACACCTATTCACACCTAATCATGCACATAAC

Full Affymetrix probeset data:

Annotations for 1640465_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime