Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640466_s_at:

>probe:Drosophila_2:1640466_s_at:277:109; Interrogation_Position=484; Antisense; AGAAGCCCATCATTGCTGCCGTGAA
>probe:Drosophila_2:1640466_s_at:497:333; Interrogation_Position=498; Antisense; GCTGCCGTGAATGGTTACGCCTTGG
>probe:Drosophila_2:1640466_s_at:494:595; Interrogation_Position=531; Antisense; TGTGAGCTGGCCATGATGTGCGACA
>probe:Drosophila_2:1640466_s_at:453:507; Interrogation_Position=548; Antisense; GTGCGACATCATATATGCCGGTGAC
>probe:Drosophila_2:1640466_s_at:446:729; Interrogation_Position=583; Antisense; TTGGTCAGCCTGAAATTGCCCTGGG
>probe:Drosophila_2:1640466_s_at:368:609; Interrogation_Position=640; Antisense; TGACCCGCGTCGTTGGCAAGTCCAA
>probe:Drosophila_2:1640466_s_at:661:585; Interrogation_Position=670; Antisense; TGGAAATGTGCCTCACCGGCAATAT
>probe:Drosophila_2:1640466_s_at:404:145; Interrogation_Position=799; Antisense; ACTCCAATCTGATCGTGCAGCTGTG
>probe:Drosophila_2:1640466_s_at:718:419; Interrogation_Position=828; Antisense; GAGGCGGTTAACACGGCTTACGAGA
>probe:Drosophila_2:1640466_s_at:519:425; Interrogation_Position=849; Antisense; GAGACCACTCTCCAAGAGGGCCTGA
>probe:Drosophila_2:1640466_s_at:624:81; Interrogation_Position=865; Antisense; AGGGCCTGAAGTTCGAGCGTCGCAC
>probe:Drosophila_2:1640466_s_at:423:355; Interrogation_Position=919; Antisense; GCAAGGAGGGCATGACCGCTTTCGC
>probe:Drosophila_2:1640466_s_at:254:319; Interrogation_Position=952; Antisense; GCCCTGCCAAGTTTACCAACGAGTA
>probe:Drosophila_2:1640466_s_at:145:237; Interrogation_Position=992; Antisense; AATCCCAGCCAGCTTTGCATTTATA

Paste this into a BLAST search page for me
AGAAGCCCATCATTGCTGCCGTGAAGCTGCCGTGAATGGTTACGCCTTGGTGTGAGCTGGCCATGATGTGCGACAGTGCGACATCATATATGCCGGTGACTTGGTCAGCCTGAAATTGCCCTGGGTGACCCGCGTCGTTGGCAAGTCCAATGGAAATGTGCCTCACCGGCAATATACTCCAATCTGATCGTGCAGCTGTGGAGGCGGTTAACACGGCTTACGAGAGAGACCACTCTCCAAGAGGGCCTGAAGGGCCTGAAGTTCGAGCGTCGCACGCAAGGAGGGCATGACCGCTTTCGCGCCCTGCCAAGTTTACCAACGAGTAAATCCCAGCCAGCTTTGCATTTATA

Full Affymetrix probeset data:

Annotations for 1640466_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime