Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640468_a_at:

>probe:Drosophila_2:1640468_a_at:584:465; Interrogation_Position=109; Antisense; GATTGTTTGTTCAGGTCCTACATGA
>probe:Drosophila_2:1640468_a_at:433:79; Interrogation_Position=121; Antisense; AGGTCCTACATGATAATCGCTCTAA
>probe:Drosophila_2:1640468_a_at:722:43; Interrogation_Position=136; Antisense; ATCGCTCTAACCGTAAATGCCCTAA
>probe:Drosophila_2:1640468_a_at:641:335; Interrogation_Position=168; Antisense; GCTGCTGATAGTCGGTTTTTTCTTC
>probe:Drosophila_2:1640468_a_at:560:89; Interrogation_Position=240; Antisense; AGTACTCTTCCTGGCAACATGGTTG
>probe:Drosophila_2:1640468_a_at:695:445; Interrogation_Position=270; Antisense; GATGCTGACTATACTGTTTGCACAA
>probe:Drosophila_2:1640468_a_at:60:13; Interrogation_Position=351; Antisense; ATTCTACGAAAGTCGCTGCCAGTGC
>probe:Drosophila_2:1640468_a_at:150:305; Interrogation_Position=369; Antisense; CCAGTGCTGCGGAGTTTTGGGACCT
>probe:Drosophila_2:1640468_a_at:121:697; Interrogation_Position=383; Antisense; TTTTGGGACCTGACGACTACAAGTT
>probe:Drosophila_2:1640468_a_at:447:365; Interrogation_Position=417; Antisense; GAATATCCCAAAATCCTGTTACAAG
>probe:Drosophila_2:1640468_a_at:303:221; Interrogation_Position=453; Antisense; AAGGGATGAGGACCTGTACCGATCA
>probe:Drosophila_2:1640468_a_at:377:43; Interrogation_Position=517; Antisense; ATCCATGTGATCTCCTTCGTAATTC
>probe:Drosophila_2:1640468_a_at:235:435; Interrogation_Position=565; Antisense; GAGGTATTCCTTATTATCCTGTTAA
>probe:Drosophila_2:1640468_a_at:609:679; Interrogation_Position=612; Antisense; TATGTGGTCTGAGCGGGTCACCGAA

Paste this into a BLAST search page for me
GATTGTTTGTTCAGGTCCTACATGAAGGTCCTACATGATAATCGCTCTAAATCGCTCTAACCGTAAATGCCCTAAGCTGCTGATAGTCGGTTTTTTCTTCAGTACTCTTCCTGGCAACATGGTTGGATGCTGACTATACTGTTTGCACAAATTCTACGAAAGTCGCTGCCAGTGCCCAGTGCTGCGGAGTTTTGGGACCTTTTTGGGACCTGACGACTACAAGTTGAATATCCCAAAATCCTGTTACAAGAAGGGATGAGGACCTGTACCGATCAATCCATGTGATCTCCTTCGTAATTCGAGGTATTCCTTATTATCCTGTTAATATGTGGTCTGAGCGGGTCACCGAA

Full Affymetrix probeset data:

Annotations for 1640468_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime