Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640469_at:

>probe:Drosophila_2:1640469_at:113:105; Interrogation_Position=128; Antisense; AGACGCTTCTCATCCCCAAGGATGC
>probe:Drosophila_2:1640469_at:29:79; Interrogation_Position=146; Antisense; AGGATGCCCAGATCCAGAACGTGCA
>probe:Drosophila_2:1640469_at:59:629; Interrogation_Position=158; Antisense; TCCAGAACGTGCAGGAGGGCATCGA
>probe:Drosophila_2:1640469_at:238:171; Interrogation_Position=16; Antisense; AAAGTGTTCGCGCTGTGTTCGATGC
>probe:Drosophila_2:1640469_at:145:121; Interrogation_Position=182; Antisense; AGCTGGGCGCGTACGAGCAGATACC
>probe:Drosophila_2:1640469_at:252:489; Interrogation_Position=192; Antisense; GTACGAGCAGATACCCGGCAACCAG
>probe:Drosophila_2:1640469_at:191:347; Interrogation_Position=218; Antisense; GCATCAATCTCTTCGAGATCCTCGG
>probe:Drosophila_2:1640469_at:718:275; Interrogation_Position=228; Antisense; CTTCGAGATCCTCGGCGACCAGGTG
>probe:Drosophila_2:1640469_at:404:129; Interrogation_Position=245; Antisense; ACCAGGTGCCCTCCGAGGTGATAAA
>probe:Drosophila_2:1640469_at:407:31; Interrogation_Position=265; Antisense; ATAAACAACCTGCAGTCCCAGGTCG
>probe:Drosophila_2:1640469_at:438:79; Interrogation_Position=284; Antisense; AGGTCGACCAGATCGGTCGCAACTA
>probe:Drosophila_2:1640469_at:581:233; Interrogation_Position=65; Antisense; AATCCCTGCCCCAGAATCGCGAGGG
>probe:Drosophila_2:1640469_at:559:235; Interrogation_Position=79; Antisense; AATCGCGAGGGTGCCGCCTACACGA
>probe:Drosophila_2:1640469_at:720:277; Interrogation_Position=96; Antisense; CTACACGAACGAGGCGATCCGGCAG

Paste this into a BLAST search page for me
AGACGCTTCTCATCCCCAAGGATGCAGGATGCCCAGATCCAGAACGTGCATCCAGAACGTGCAGGAGGGCATCGAAAAGTGTTCGCGCTGTGTTCGATGCAGCTGGGCGCGTACGAGCAGATACCGTACGAGCAGATACCCGGCAACCAGGCATCAATCTCTTCGAGATCCTCGGCTTCGAGATCCTCGGCGACCAGGTGACCAGGTGCCCTCCGAGGTGATAAAATAAACAACCTGCAGTCCCAGGTCGAGGTCGACCAGATCGGTCGCAACTAAATCCCTGCCCCAGAATCGCGAGGGAATCGCGAGGGTGCCGCCTACACGACTACACGAACGAGGCGATCCGGCAG

Full Affymetrix probeset data:

Annotations for 1640469_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime