Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640472_at:

>probe:Drosophila_2:1640472_at:456:299; Interrogation_Position=3689; Antisense; GGCGGACGTACGGATAGTTCAGACT
>probe:Drosophila_2:1640472_at:580:673; Interrogation_Position=3725; Antisense; TATCAAGTTTTTGCAACGCGGGATT
>probe:Drosophila_2:1640472_at:323:69; Interrogation_Position=3762; Antisense; AGGCCAGGGCGCTAGGAACCATATT
>probe:Drosophila_2:1640472_at:680:155; Interrogation_Position=3874; Antisense; ACAGCGGCGCGGGATTCTTATAAGA
>probe:Drosophila_2:1640472_at:198:517; Interrogation_Position=3911; Antisense; GTGGGACCTTTTTTGACGGCAGCGT
>probe:Drosophila_2:1640472_at:231:689; Interrogation_Position=3941; Antisense; TTTAGGACTGCAGCGCGGGAATTTC
>probe:Drosophila_2:1640472_at:120:245; Interrogation_Position=3992; Antisense; AATTTTTCGGCAATTGGTCAGCCAT
>probe:Drosophila_2:1640472_at:529:649; Interrogation_Position=4009; Antisense; TCAGCCATCGCATTCCATATACATG
>probe:Drosophila_2:1640472_at:327:269; Interrogation_Position=4030; Antisense; CATGCGTGTCACTCCATTTATTGAT
>probe:Drosophila_2:1640472_at:652:667; Interrogation_Position=4070; Antisense; TACTTAGGTGGCGTGATCAGCGTAA
>probe:Drosophila_2:1640472_at:286:239; Interrogation_Position=4093; Antisense; AATCACGCCTCCAAAAATACGCATC
>probe:Drosophila_2:1640472_at:53:343; Interrogation_Position=4113; Antisense; GCATCCCTGATTATCCCTTATATGG
>probe:Drosophila_2:1640472_at:401:687; Interrogation_Position=4161; Antisense; TATTTACACTTCTGGAATACCGGAA
>probe:Drosophila_2:1640472_at:241:253; Interrogation_Position=4188; Antisense; CAACCCCAATACTTATGCCGATGAT

Paste this into a BLAST search page for me
GGCGGACGTACGGATAGTTCAGACTTATCAAGTTTTTGCAACGCGGGATTAGGCCAGGGCGCTAGGAACCATATTACAGCGGCGCGGGATTCTTATAAGAGTGGGACCTTTTTTGACGGCAGCGTTTTAGGACTGCAGCGCGGGAATTTCAATTTTTCGGCAATTGGTCAGCCATTCAGCCATCGCATTCCATATACATGCATGCGTGTCACTCCATTTATTGATTACTTAGGTGGCGTGATCAGCGTAAAATCACGCCTCCAAAAATACGCATCGCATCCCTGATTATCCCTTATATGGTATTTACACTTCTGGAATACCGGAACAACCCCAATACTTATGCCGATGAT

Full Affymetrix probeset data:

Annotations for 1640472_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime