FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640473_at:

>probe:Drosophila_2:1640473_at:116:485; Interrogation_Position=4335; Antisense; GTATGCCACTATCGAACAGCTGCTG
>probe:Drosophila_2:1640473_at:7:611; Interrogation_Position=4382; Antisense; TGACCTCTCATTCCGTTTCGGAGAT
>probe:Drosophila_2:1640473_at:695:639; Interrogation_Position=4399; Antisense; TCGGAGATCGAGCATCTGTGCCAAA
>probe:Drosophila_2:1640473_at:133:313; Interrogation_Position=4456; Antisense; GCCAGCGATAGTCCGCAGCGATTGA
>probe:Drosophila_2:1640473_at:662:189; Interrogation_Position=4487; Antisense; AACATGGTGGTTACTACGCCGTGAC
>probe:Drosophila_2:1640473_at:625:321; Interrogation_Position=4528; Antisense; GCCCAACAGGCCATTCTTTCAAGAA
>probe:Drosophila_2:1640473_at:587:613; Interrogation_Position=4556; Antisense; TGAATCAACGATTGCCGGGAGCGCG
>probe:Drosophila_2:1640473_at:189:417; Interrogation_Position=4574; Antisense; GAGCGCGGGACTTGCAGCACTATGC
>probe:Drosophila_2:1640473_at:339:143; Interrogation_Position=4601; Antisense; ACAGCTTGCGGTTTCTCGTCAGGGT
>probe:Drosophila_2:1640473_at:582:47; Interrogation_Position=4678; Antisense; ATCCTTTGCGATGTCTGCGTGAATG
>probe:Drosophila_2:1640473_at:653:229; Interrogation_Position=4699; Antisense; AATGTGGCTCGCTTTTCGTTGAGTC
>probe:Drosophila_2:1640473_at:6:383; Interrogation_Position=4747; Antisense; GAACGAATCCTTGACAGCAGCGAGT
>probe:Drosophila_2:1640473_at:400:521; Interrogation_Position=4853; Antisense; GTGGCACTCTTGAAACCGGCTATAT
>probe:Drosophila_2:1640473_at:165:201; Interrogation_Position=4866; Antisense; AACCGGCTATATTCATTGTGGCTAC

Paste this into a BLAST search page for me
GTATGCCACTATCGAACAGCTGCTGTGACCTCTCATTCCGTTTCGGAGATTCGGAGATCGAGCATCTGTGCCAAAGCCAGCGATAGTCCGCAGCGATTGAAACATGGTGGTTACTACGCCGTGACGCCCAACAGGCCATTCTTTCAAGAATGAATCAACGATTGCCGGGAGCGCGGAGCGCGGGACTTGCAGCACTATGCACAGCTTGCGGTTTCTCGTCAGGGTATCCTTTGCGATGTCTGCGTGAATGAATGTGGCTCGCTTTTCGTTGAGTCGAACGAATCCTTGACAGCAGCGAGTGTGGCACTCTTGAAACCGGCTATATAACCGGCTATATTCATTGTGGCTAC

Full Affymetrix probeset data:

Annotations for 1640473_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720