FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640476_at:

>probe:Drosophila_2:1640476_at:169:531; Interrogation_Position=1046; Antisense; GGGTTACATCCATGGTACTGGTCTT
>probe:Drosophila_2:1640476_at:46:539; Interrogation_Position=1059; Antisense; GGTACTGGTCTTGGCTCAGATGGAA
>probe:Drosophila_2:1640476_at:188:81; Interrogation_Position=1123; Antisense; AGGGTCGATCTCTAGATGCCTGCAT
>probe:Drosophila_2:1640476_at:350:381; Interrogation_Position=1194; Antisense; GAACGAAAGCTAAAGCGCGCCCAGC
>probe:Drosophila_2:1640476_at:63:71; Interrogation_Position=1243; Antisense; AGGCCTACGTCCGTGAGTCACAACG
>probe:Drosophila_2:1640476_at:261:495; Interrogation_Position=1259; Antisense; GTCACAACGTGTGGATGTCTTTACA
>probe:Drosophila_2:1640476_at:238:147; Interrogation_Position=1320; Antisense; ACTCAGCAAGGCGAGCAGGTGACCA
>probe:Drosophila_2:1640476_at:392:213; Interrogation_Position=1353; Antisense; AAGACCAACGAGCTACAGCAGCACT
>probe:Drosophila_2:1640476_at:209:111; Interrogation_Position=1369; Antisense; AGCAGCACTCAACCAAAACTCTTAA
>probe:Drosophila_2:1640476_at:368:53; Interrogation_Position=1443; Antisense; ATGGCCAAGGTTAAACAGTCCCTGG
>probe:Drosophila_2:1640476_at:10:503; Interrogation_Position=1460; Antisense; GTCCCTGGACCGGAATTCTGGAGAT
>probe:Drosophila_2:1640476_at:35:427; Interrogation_Position=1480; Antisense; GAGATGCGCAGCTCCAGAAGCGACT
>probe:Drosophila_2:1640476_at:418:179; Interrogation_Position=1527; Antisense; AAACAGGAGCTAGCCACGCTGCAGG
>probe:Drosophila_2:1640476_at:212:349; Interrogation_Position=1547; Antisense; GCAGGCACAGGAACGCAGCTTAAGC

Paste this into a BLAST search page for me
GGGTTACATCCATGGTACTGGTCTTGGTACTGGTCTTGGCTCAGATGGAAAGGGTCGATCTCTAGATGCCTGCATGAACGAAAGCTAAAGCGCGCCCAGCAGGCCTACGTCCGTGAGTCACAACGGTCACAACGTGTGGATGTCTTTACAACTCAGCAAGGCGAGCAGGTGACCAAAGACCAACGAGCTACAGCAGCACTAGCAGCACTCAACCAAAACTCTTAAATGGCCAAGGTTAAACAGTCCCTGGGTCCCTGGACCGGAATTCTGGAGATGAGATGCGCAGCTCCAGAAGCGACTAAACAGGAGCTAGCCACGCTGCAGGGCAGGCACAGGAACGCAGCTTAAGC

Full Affymetrix probeset data:

Annotations for 1640476_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720