FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640477_at:

>probe:Drosophila_2:1640477_at:152:153; Interrogation_Position=1006; Antisense; ACAGGTCACCTTGTGGTCAATCTTA
>probe:Drosophila_2:1640477_at:187:475; Interrogation_Position=1042; Antisense; GTTAACGAGCTGCTGATAGCCAAGA
>probe:Drosophila_2:1640477_at:640:549; Interrogation_Position=1144; Antisense; GGAGTAGTGGACATCAGCAACATTT
>probe:Drosophila_2:1640477_at:544:189; Interrogation_Position=1162; Antisense; AACATTTGTGCACCCGAAGATCTTC
>probe:Drosophila_2:1640477_at:112:375; Interrogation_Position=1177; Antisense; GAAGATCTTCCCGATTTAATTTGAG
>probe:Drosophila_2:1640477_at:611:95; Interrogation_Position=674; Antisense; AGATTCGCACAGAGATCGCTCGGCA
>probe:Drosophila_2:1640477_at:609:377; Interrogation_Position=798; Antisense; GAACCAGGCCAAACTGCCCTTTAAG
>probe:Drosophila_2:1640477_at:561:527; Interrogation_Position=827; Antisense; GGGATGAGGCCGACCATTACTTGCT
>probe:Drosophila_2:1640477_at:654:413; Interrogation_Position=838; Antisense; GACCATTACTTGCTCCAACTGGAGG
>probe:Drosophila_2:1640477_at:599:513; Interrogation_Position=862; Antisense; GTGTACAGACACCTGGATACCTCTC
>probe:Drosophila_2:1640477_at:247:457; Interrogation_Position=877; Antisense; GATACCTCTCTAATTGACGTCGATG
>probe:Drosophila_2:1640477_at:506:97; Interrogation_Position=938; Antisense; AGATCTTCCAGATCGCGTACAGCGA
>probe:Drosophila_2:1640477_at:360:205; Interrogation_Position=970; Antisense; AAGCCGGATGAGTCCACTGTGCAGC
>probe:Drosophila_2:1640477_at:55:617; Interrogation_Position=989; Antisense; TGCAGCGTTCCCAGATTACAGGTCA

Paste this into a BLAST search page for me
ACAGGTCACCTTGTGGTCAATCTTAGTTAACGAGCTGCTGATAGCCAAGAGGAGTAGTGGACATCAGCAACATTTAACATTTGTGCACCCGAAGATCTTCGAAGATCTTCCCGATTTAATTTGAGAGATTCGCACAGAGATCGCTCGGCAGAACCAGGCCAAACTGCCCTTTAAGGGGATGAGGCCGACCATTACTTGCTGACCATTACTTGCTCCAACTGGAGGGTGTACAGACACCTGGATACCTCTCGATACCTCTCTAATTGACGTCGATGAGATCTTCCAGATCGCGTACAGCGAAAGCCGGATGAGTCCACTGTGCAGCTGCAGCGTTCCCAGATTACAGGTCA

Full Affymetrix probeset data:

Annotations for 1640477_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720