FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640478_at:

>probe:Drosophila_2:1640478_at:511:25; Interrogation_Position=112; Antisense; ATAGATGCCAGATTCGTGCCCGGTC
>probe:Drosophila_2:1640478_at:240:503; Interrogation_Position=134; Antisense; GTCCGCCTTCAATACCCAGTATTTG
>probe:Drosophila_2:1640478_at:609:481; Interrogation_Position=152; Antisense; GTATTTGCAAAAAACCACCGCCACG
>probe:Drosophila_2:1640478_at:245:715; Interrogation_Position=177; Antisense; TTCGGAGGGCGTTTGTGCCATTGAT
>probe:Drosophila_2:1640478_at:190:729; Interrogation_Position=189; Antisense; TTGTGCCATTGATATCGAGGGATAC
>probe:Drosophila_2:1640478_at:660:137; Interrogation_Position=218; Antisense; ACGATCCGATAACATTTGACTGCAA
>probe:Drosophila_2:1640478_at:576:313; Interrogation_Position=24; Antisense; GCCAGTCCAGATGTCTCGACACAAG
>probe:Drosophila_2:1640478_at:219:569; Interrogation_Position=258; Antisense; GGCATGCCACTTGATTCGTGGCCAG
>probe:Drosophila_2:1640478_at:603:639; Interrogation_Position=273; Antisense; TCGTGGCCAGAGTTTCGGCAGTCAA
>probe:Drosophila_2:1640478_at:523:89; Interrogation_Position=292; Antisense; AGTCAACAGGATTGCATTTCCACCT
>probe:Drosophila_2:1640478_at:535:19; Interrogation_Position=307; Antisense; ATTTCCACCTGCATCCATGGGATAC
>probe:Drosophila_2:1640478_at:444:529; Interrogation_Position=325; Antisense; GGGATACGCCGGAATCATGACTTTT
>probe:Drosophila_2:1640478_at:10:159; Interrogation_Position=44; Antisense; ACAAGCCCGCGTCGGTGGTGCTAAC
>probe:Drosophila_2:1640478_at:345:279; Interrogation_Position=64; Antisense; CTAACGCTGCTGTTGGTGGTGCTGT

Paste this into a BLAST search page for me
ATAGATGCCAGATTCGTGCCCGGTCGTCCGCCTTCAATACCCAGTATTTGGTATTTGCAAAAAACCACCGCCACGTTCGGAGGGCGTTTGTGCCATTGATTTGTGCCATTGATATCGAGGGATACACGATCCGATAACATTTGACTGCAAGCCAGTCCAGATGTCTCGACACAAGGGCATGCCACTTGATTCGTGGCCAGTCGTGGCCAGAGTTTCGGCAGTCAAAGTCAACAGGATTGCATTTCCACCTATTTCCACCTGCATCCATGGGATACGGGATACGCCGGAATCATGACTTTTACAAGCCCGCGTCGGTGGTGCTAACCTAACGCTGCTGTTGGTGGTGCTGT

Full Affymetrix probeset data:

Annotations for 1640478_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720