FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640479_at:

>probe:Drosophila_2:1640479_at:510:9; Interrogation_Position=1450; Antisense; ATTCCCGATGATTTTGCGCGCCAAG
>probe:Drosophila_2:1640479_at:566:545; Interrogation_Position=1524; Antisense; GGATCTATGCCAACTACTTCGCAAA
>probe:Drosophila_2:1640479_at:691:667; Interrogation_Position=1538; Antisense; TACTTCGCAAATCCCTATGACATGA
>probe:Drosophila_2:1640479_at:304:471; Interrogation_Position=1571; Antisense; GTTCGCGGCATCGAGCAGGCAGTAA
>probe:Drosophila_2:1640479_at:395:91; Interrogation_Position=1595; Antisense; AGTTTACTGGATATGCCCGCATTTA
>probe:Drosophila_2:1640479_at:193:421; Interrogation_Position=1681; Antisense; GAGCAGCGCCTATTGGGCATGTTAT
>probe:Drosophila_2:1640479_at:685:601; Interrogation_Position=1700; Antisense; TGTTATGCACGACACTTTACCTTCA
>probe:Drosophila_2:1640479_at:354:697; Interrogation_Position=1728; Antisense; TTTACCACTATTCAGGAACCGCCAA
>probe:Drosophila_2:1640479_at:323:213; Interrogation_Position=1751; Antisense; AAGATGGGTCCTCGATCGGATCCCT
>probe:Drosophila_2:1640479_at:568:67; Interrogation_Position=1806; Antisense; ATGGCATCGACAAACTGCGCGTTGT
>probe:Drosophila_2:1640479_at:714:207; Interrogation_Position=1837; Antisense; AAGCATTATGCCCTATTTGATCTCG
>probe:Drosophila_2:1640479_at:572:689; Interrogation_Position=1852; Antisense; TTTGATCTCGGGTCATCCCAATGGA
>probe:Drosophila_2:1640479_at:595:553; Interrogation_Position=1874; Antisense; GGACCCGTCTACCTAATAGCTGAAA
>probe:Drosophila_2:1640479_at:286:111; Interrogation_Position=1944; Antisense; AGCACACTATGTTTTCTTAAGCCGA

Paste this into a BLAST search page for me
ATTCCCGATGATTTTGCGCGCCAAGGGATCTATGCCAACTACTTCGCAAATACTTCGCAAATCCCTATGACATGAGTTCGCGGCATCGAGCAGGCAGTAAAGTTTACTGGATATGCCCGCATTTAGAGCAGCGCCTATTGGGCATGTTATTGTTATGCACGACACTTTACCTTCATTTACCACTATTCAGGAACCGCCAAAAGATGGGTCCTCGATCGGATCCCTATGGCATCGACAAACTGCGCGTTGTAAGCATTATGCCCTATTTGATCTCGTTTGATCTCGGGTCATCCCAATGGAGGACCCGTCTACCTAATAGCTGAAAAGCACACTATGTTTTCTTAAGCCGA

Full Affymetrix probeset data:

Annotations for 1640479_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720