FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640480_at:

>probe:Drosophila_2:1640480_at:605:279; Interrogation_Position=116; Antisense; CTACATTTCCGCCTGTTTTGAACAG
>probe:Drosophila_2:1640480_at:143:691; Interrogation_Position=132; Antisense; TTTGAACAGACCCACTACCCTAGAA
>probe:Drosophila_2:1640480_at:236:107; Interrogation_Position=170; Antisense; AGAACTATCAGCTCCTGTGGAAGGA
>probe:Drosophila_2:1640480_at:173:549; Interrogation_Position=192; Antisense; GGAGGACTTTCTGAACCGAATGCGA
>probe:Drosophila_2:1640480_at:539:687; Interrogation_Position=226; Antisense; TATTACATGATCTCCGCCAGTCGGG
>probe:Drosophila_2:1640480_at:620:151; Interrogation_Position=310; Antisense; ACAGCACAACCCGATTTTAACTACA
>probe:Drosophila_2:1640480_at:145:17; Interrogation_Position=323; Antisense; ATTTTAACTACAAAGCCATGCCCCA
>probe:Drosophila_2:1640480_at:247:203; Interrogation_Position=335; Antisense; AAGCCATGCCCCAAGAGCTAAACAT
>probe:Drosophila_2:1640480_at:113:179; Interrogation_Position=354; Antisense; AAACATCTCCAGTCGAAAACGTCGT
>probe:Drosophila_2:1640480_at:11:447; Interrogation_Position=385; Antisense; GATGCAAGGCCGAATCTGCTGACCA
>probe:Drosophila_2:1640480_at:729:179; Interrogation_Position=490; Antisense; AAACAAGAGTCCGATTCCGAACAGG
>probe:Drosophila_2:1640480_at:346:127; Interrogation_Position=566; Antisense; ACGACTACGGTGCAACGTACTTTGA
>probe:Drosophila_2:1640480_at:144:269; Interrogation_Position=624; Antisense; CTTGGACGATGGTCCCGTTTACTGA
>probe:Drosophila_2:1640480_at:583:227; Interrogation_Position=63; Antisense; AATGGCCATGTTGGGATGCACAAAG

Paste this into a BLAST search page for me
CTACATTTCCGCCTGTTTTGAACAGTTTGAACAGACCCACTACCCTAGAAAGAACTATCAGCTCCTGTGGAAGGAGGAGGACTTTCTGAACCGAATGCGATATTACATGATCTCCGCCAGTCGGGACAGCACAACCCGATTTTAACTACAATTTTAACTACAAAGCCATGCCCCAAAGCCATGCCCCAAGAGCTAAACATAAACATCTCCAGTCGAAAACGTCGTGATGCAAGGCCGAATCTGCTGACCAAAACAAGAGTCCGATTCCGAACAGGACGACTACGGTGCAACGTACTTTGACTTGGACGATGGTCCCGTTTACTGAAATGGCCATGTTGGGATGCACAAAG

Full Affymetrix probeset data:

Annotations for 1640480_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720