FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640482_at:

>probe:Drosophila_2:1640482_at:689:491; Interrogation_Position=139; Antisense; GTAACACTGACATTGTCGCCGGTGA
>probe:Drosophila_2:1640482_at:194:569; Interrogation_Position=169; Antisense; GGCAGTGTCCTGACCATCATAATTA
>probe:Drosophila_2:1640482_at:162:5; Interrogation_Position=193; Antisense; ATTGGTGTGGCCATCGCGATACGAA
>probe:Drosophila_2:1640482_at:670:355; Interrogation_Position=215; Antisense; GAATATTCGTGGTGACATTTGTGCA
>probe:Drosophila_2:1640482_at:398:151; Interrogation_Position=229; Antisense; ACATTTGTGCACAATTTGCGGCGGA
>probe:Drosophila_2:1640482_at:603:19; Interrogation_Position=242; Antisense; ATTTGCGGCGGAATCGTCATCATGG
>probe:Drosophila_2:1640482_at:12:123; Interrogation_Position=304; Antisense; AGCGATGTCTTCAAGGGCGGCAACT
>probe:Drosophila_2:1640482_at:310:299; Interrogation_Position=338; Antisense; CGCGATGGCAGCACACGGACATAAA
>probe:Drosophila_2:1640482_at:474:27; Interrogation_Position=412; Antisense; ATACCATCGCAATACGTCGGTGGGA
>probe:Drosophila_2:1640482_at:275:567; Interrogation_Position=454; Antisense; GGCAGCAATGCCTCCAACGTGGGCA
>probe:Drosophila_2:1640482_at:357:549; Interrogation_Position=568; Antisense; GGAGGAGCCACATCGTCAGCATCTG
>probe:Drosophila_2:1640482_at:481:35; Interrogation_Position=605; Antisense; ATCAGTTTGCATCTGGCACAGCGGC
>probe:Drosophila_2:1640482_at:104:519; Interrogation_Position=651; Antisense; GTGGTCACCCAATGGCAATGATCTC
>probe:Drosophila_2:1640482_at:82:461; Interrogation_Position=97; Antisense; GATTTCATAATTGGCTCAACAGCTT

Paste this into a BLAST search page for me
GTAACACTGACATTGTCGCCGGTGAGGCAGTGTCCTGACCATCATAATTAATTGGTGTGGCCATCGCGATACGAAGAATATTCGTGGTGACATTTGTGCAACATTTGTGCACAATTTGCGGCGGAATTTGCGGCGGAATCGTCATCATGGAGCGATGTCTTCAAGGGCGGCAACTCGCGATGGCAGCACACGGACATAAAATACCATCGCAATACGTCGGTGGGAGGCAGCAATGCCTCCAACGTGGGCAGGAGGAGCCACATCGTCAGCATCTGATCAGTTTGCATCTGGCACAGCGGCGTGGTCACCCAATGGCAATGATCTCGATTTCATAATTGGCTCAACAGCTT

Full Affymetrix probeset data:

Annotations for 1640482_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720