FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640484_at:

>probe:Drosophila_2:1640484_at:349:73; Interrogation_Position=2085; Antisense; AGGACCTCGTCCTGAGAAGGGAAAT
>probe:Drosophila_2:1640484_at:558:369; Interrogation_Position=2139; Antisense; GAAGGCCCGGACAAGTTCTGATACC
>probe:Drosophila_2:1640484_at:167:245; Interrogation_Position=2183; Antisense; AATTTCCTGATGAATCGGCCTCTCA
>probe:Drosophila_2:1640484_at:43:361; Interrogation_Position=2254; Antisense; GCAAGACGAGTTCCAGGCTTAGCAA
>probe:Drosophila_2:1640484_at:106:571; Interrogation_Position=2269; Antisense; GGCTTAGCAATGTGCTCAGCTCCAA
>probe:Drosophila_2:1640484_at:183:281; Interrogation_Position=2283; Antisense; CTCAGCTCCAAGTCATATCCTTAAA
>probe:Drosophila_2:1640484_at:38:107; Interrogation_Position=2320; Antisense; AGACACCATCAAGAGCTCCGCAAAT
>probe:Drosophila_2:1640484_at:294:243; Interrogation_Position=2342; Antisense; AATATCCAAGATGAAGCCTCGAGCT
>probe:Drosophila_2:1640484_at:373:597; Interrogation_Position=2370; Antisense; TGTCCAGCTTTGATTACTCGCCGAT
>probe:Drosophila_2:1640484_at:197:575; Interrogation_Position=2397; Antisense; GGCGGCAGTGTCCTTATTTGCCAAC
>probe:Drosophila_2:1640484_at:508:203; Interrogation_Position=2428; Antisense; AAGCCGCAAGCTCTGACGGTCGTGA
>probe:Drosophila_2:1640484_at:278:701; Interrogation_Position=2565; Antisense; TTTTGCGATGCAGTTCAGTCCAGTT
>probe:Drosophila_2:1640484_at:292:267; Interrogation_Position=2580; Antisense; CAGTCCAGTTAATTGCCTAATCCCA
>probe:Drosophila_2:1640484_at:389:31; Interrogation_Position=2626; Antisense; ATAAAATGCTTTCCCCGTCAAATCT

Paste this into a BLAST search page for me
AGGACCTCGTCCTGAGAAGGGAAATGAAGGCCCGGACAAGTTCTGATACCAATTTCCTGATGAATCGGCCTCTCAGCAAGACGAGTTCCAGGCTTAGCAAGGCTTAGCAATGTGCTCAGCTCCAACTCAGCTCCAAGTCATATCCTTAAAAGACACCATCAAGAGCTCCGCAAATAATATCCAAGATGAAGCCTCGAGCTTGTCCAGCTTTGATTACTCGCCGATGGCGGCAGTGTCCTTATTTGCCAACAAGCCGCAAGCTCTGACGGTCGTGATTTTGCGATGCAGTTCAGTCCAGTTCAGTCCAGTTAATTGCCTAATCCCAATAAAATGCTTTCCCCGTCAAATCT

Full Affymetrix probeset data:

Annotations for 1640484_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720