Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640485_at:

>probe:Drosophila_2:1640485_at:580:41; Interrogation_Position=1529; Antisense; ATCGGTATCGGTGACTACATGCGCT
>probe:Drosophila_2:1640485_at:663:153; Interrogation_Position=1730; Antisense; ACAGTGCGTGCCATTAGTCATCAGC
>probe:Drosophila_2:1640485_at:143:141; Interrogation_Position=1761; Antisense; ACGTGGTGAATCGTCCTCGGGTCAT
>probe:Drosophila_2:1640485_at:454:531; Interrogation_Position=1779; Antisense; GGGTCATGGCGCGATATGCCCAGAA
>probe:Drosophila_2:1640485_at:681:241; Interrogation_Position=1823; Antisense; AATAGAAGGTCTCCCGTGCAATATA
>probe:Drosophila_2:1640485_at:724:23; Interrogation_Position=1845; Antisense; ATATCCGTTGGCTAAGTGGACGCAT
>probe:Drosophila_2:1640485_at:374:519; Interrogation_Position=1860; Antisense; GTGGACGCATATACTTCGAATACTG
>probe:Drosophila_2:1640485_at:547:365; Interrogation_Position=1877; Antisense; GAATACTGTCTGTTTCTGTCAGCCT
>probe:Drosophila_2:1640485_at:543:285; Interrogation_Position=1892; Antisense; CTGTCAGCCTTCAAGCTATATCTGC
>probe:Drosophila_2:1640485_at:514:687; Interrogation_Position=1908; Antisense; TATATCTGCTCGACTGGTACTTCAA
>probe:Drosophila_2:1640485_at:283:711; Interrogation_Position=1928; Antisense; TTCAACATCCTGTACCTAGTGGGTC
>probe:Drosophila_2:1640485_at:432:283; Interrogation_Position=1959; Antisense; CTGCCTCTGCGAGAACCGTAATGAA
>probe:Drosophila_2:1640485_at:497:453; Interrogation_Position=1985; Antisense; GATATAATGCAACCTCCGGAGCCGA
>probe:Drosophila_2:1640485_at:494:669; Interrogation_Position=2025; Antisense; TACGCTAACCGTTTGCTTTACGTCT

Paste this into a BLAST search page for me
ATCGGTATCGGTGACTACATGCGCTACAGTGCGTGCCATTAGTCATCAGCACGTGGTGAATCGTCCTCGGGTCATGGGTCATGGCGCGATATGCCCAGAAAATAGAAGGTCTCCCGTGCAATATAATATCCGTTGGCTAAGTGGACGCATGTGGACGCATATACTTCGAATACTGGAATACTGTCTGTTTCTGTCAGCCTCTGTCAGCCTTCAAGCTATATCTGCTATATCTGCTCGACTGGTACTTCAATTCAACATCCTGTACCTAGTGGGTCCTGCCTCTGCGAGAACCGTAATGAAGATATAATGCAACCTCCGGAGCCGATACGCTAACCGTTTGCTTTACGTCT

Full Affymetrix probeset data:

Annotations for 1640485_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime