FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640487_at:

>probe:Drosophila_2:1640487_at:507:73; Interrogation_Position=114; Antisense; AGGACCTGACAAGACTTCGGCCTCA
>probe:Drosophila_2:1640487_at:489:713; Interrogation_Position=140; Antisense; TTCTCAACAGCCATTTGCCCAAGAG
>probe:Drosophila_2:1640487_at:94:425; Interrogation_Position=175; Antisense; GAGTTAATTCCCGAGGAGCCACGGA
>probe:Drosophila_2:1640487_at:571:339; Interrogation_Position=210; Antisense; GCTAATGCAGAATGTGGCTCCACGT
>probe:Drosophila_2:1640487_at:717:521; Interrogation_Position=223; Antisense; GTGGCTCCACGTCGCAATGAACAAG
>probe:Drosophila_2:1640487_at:31:365; Interrogation_Position=263; Antisense; GAATAGTTGAACACCAGTCGCATCT
>probe:Drosophila_2:1640487_at:660:87; Interrogation_Position=278; Antisense; AGTCGCATCTCAAAGAGCTGCTCCA
>probe:Drosophila_2:1640487_at:273:173; Interrogation_Position=305; Antisense; AAAGACCTGTGAACTCCGAGATGGC
>probe:Drosophila_2:1640487_at:483:439; Interrogation_Position=324; Antisense; GATGGCCATACAACGTGTGCCTTTT
>probe:Drosophila_2:1640487_at:398:515; Interrogation_Position=338; Antisense; GTGTGCCTTTTGTCAAACCGTCTGA
>probe:Drosophila_2:1640487_at:379:605; Interrogation_Position=393; Antisense; TGATAGTGCCGAATCGCTCCTCGAA
>probe:Drosophila_2:1640487_at:631:385; Interrogation_Position=415; Antisense; GAACAGGTCTGTGATCCCAAAGAAT
>probe:Drosophila_2:1640487_at:239:659; Interrogation_Position=456; Antisense; TAAGTTGGCCAAGGAATTGCGCATG
>probe:Drosophila_2:1640487_at:380:379; Interrogation_Position=90; Antisense; GAAGCGAACGCTATGCTGGTCTAAA

Paste this into a BLAST search page for me
AGGACCTGACAAGACTTCGGCCTCATTCTCAACAGCCATTTGCCCAAGAGGAGTTAATTCCCGAGGAGCCACGGAGCTAATGCAGAATGTGGCTCCACGTGTGGCTCCACGTCGCAATGAACAAGGAATAGTTGAACACCAGTCGCATCTAGTCGCATCTCAAAGAGCTGCTCCAAAAGACCTGTGAACTCCGAGATGGCGATGGCCATACAACGTGTGCCTTTTGTGTGCCTTTTGTCAAACCGTCTGATGATAGTGCCGAATCGCTCCTCGAAGAACAGGTCTGTGATCCCAAAGAATTAAGTTGGCCAAGGAATTGCGCATGGAAGCGAACGCTATGCTGGTCTAAA

Full Affymetrix probeset data:

Annotations for 1640487_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720