FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640489_at:

>probe:Drosophila_2:1640489_at:143:513; Interrogation_Position=3638; Antisense; GTGAGAGTCTGAATCCCAATGTGGA
>probe:Drosophila_2:1640489_at:338:691; Interrogation_Position=3663; Antisense; TATTGGCCAGATCGAGGGTGCATTC
>probe:Drosophila_2:1640489_at:76:271; Interrogation_Position=3687; Antisense; CATGATGGGCTTGGGCTACTGGACC
>probe:Drosophila_2:1640489_at:260:141; Interrogation_Position=3704; Antisense; ACTGGACCAGCGAGCAAGTGATTGC
>probe:Drosophila_2:1640489_at:442:139; Interrogation_Position=3739; Antisense; ACGGGCGAGTGTCTCACGAATCGTA
>probe:Drosophila_2:1640489_at:154:633; Interrogation_Position=3759; Antisense; TCGTACCTGGACGTATAAGCCACCA
>probe:Drosophila_2:1640489_at:71:119; Interrogation_Position=3786; Antisense; AGCTAAGGACATACCCACTGATCTG
>probe:Drosophila_2:1640489_at:216:161; Interrogation_Position=3839; Antisense; ACAAGGCGGGCTTCATGAGATCCAA
>probe:Drosophila_2:1640489_at:206:425; Interrogation_Position=3872; Antisense; GAGAGCCAGCCATCTGTTTGTCCAT
>probe:Drosophila_2:1640489_at:293:71; Interrogation_Position=3920; Antisense; AGGCCCTGCAATCAGCTCGCGATGA
>probe:Drosophila_2:1640489_at:209:417; Interrogation_Position=4021; Antisense; GAGCCCAGCCAGTTCAAGCTGAACT
>probe:Drosophila_2:1640489_at:168:579; Interrogation_Position=4099; Antisense; GGCCACGATGGGAACGCTCCGATAA
>probe:Drosophila_2:1640489_at:550:111; Interrogation_Position=4123; Antisense; AGCACGCCAAGATAACCTGCACTTA
>probe:Drosophila_2:1640489_at:49:405; Interrogation_Position=4176; Antisense; GACTCTAGACTAGCCGACATTGTGT

Paste this into a BLAST search page for me
GTGAGAGTCTGAATCCCAATGTGGATATTGGCCAGATCGAGGGTGCATTCCATGATGGGCTTGGGCTACTGGACCACTGGACCAGCGAGCAAGTGATTGCACGGGCGAGTGTCTCACGAATCGTATCGTACCTGGACGTATAAGCCACCAAGCTAAGGACATACCCACTGATCTGACAAGGCGGGCTTCATGAGATCCAAGAGAGCCAGCCATCTGTTTGTCCATAGGCCCTGCAATCAGCTCGCGATGAGAGCCCAGCCAGTTCAAGCTGAACTGGCCACGATGGGAACGCTCCGATAAAGCACGCCAAGATAACCTGCACTTAGACTCTAGACTAGCCGACATTGTGT

Full Affymetrix probeset data:

Annotations for 1640489_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720