FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640492_at:

>probe:Drosophila_2:1640492_at:142:13; Interrogation_Position=1020; Antisense; ATTACCGGAGAGTCCATTGTGGCTG
>probe:Drosophila_2:1640492_at:391:155; Interrogation_Position=1056; Antisense; ACAGCTCGTTTGTAAGCGGTGTACA
>probe:Drosophila_2:1640492_at:116:481; Interrogation_Position=551; Antisense; GTTTGGCAAGCTCAACATTCTGGTC
>probe:Drosophila_2:1640492_at:700:149; Interrogation_Position=565; Antisense; ACATTCTGGTCAGCAATGCAGCCAC
>probe:Drosophila_2:1640492_at:421:511; Interrogation_Position=657; Antisense; GTGAAGAGTTCCTATCTGCTGGCCA
>probe:Drosophila_2:1640492_at:318:169; Interrogation_Position=710; Antisense; AAAGAACTCCAGCATCGTTTTCGTC
>probe:Drosophila_2:1640492_at:657:497; Interrogation_Position=732; Antisense; GTCTCCTCCATTGCTGGCTATGATG
>probe:Drosophila_2:1640492_at:48:51; Interrogation_Position=754; Antisense; ATGCCTTTGAGCTACTGGGAGCCTA
>probe:Drosophila_2:1640492_at:362:593; Interrogation_Position=769; Antisense; TGGGAGCCTATTCCGTCAGCAAGAC
>probe:Drosophila_2:1640492_at:383:213; Interrogation_Position=789; Antisense; AAGACCGCGCTGATTGGCTTGACCA
>probe:Drosophila_2:1640492_at:378:287; Interrogation_Position=861; Antisense; CTGGCTCCAGGAGTCATCAGGACAA
>probe:Drosophila_2:1640492_at:597:163; Interrogation_Position=940; Antisense; AAATACCCATGGGTCGTCTGGGCAC
>probe:Drosophila_2:1640492_at:585:589; Interrogation_Position=985; Antisense; TGGTCTCCTTTTTGGTCTCCGAGGA
>probe:Drosophila_2:1640492_at:539:499; Interrogation_Position=999; Antisense; GTCTCCGAGGATGCGGGCTACATTA

Paste this into a BLAST search page for me
ATTACCGGAGAGTCCATTGTGGCTGACAGCTCGTTTGTAAGCGGTGTACAGTTTGGCAAGCTCAACATTCTGGTCACATTCTGGTCAGCAATGCAGCCACGTGAAGAGTTCCTATCTGCTGGCCAAAAGAACTCCAGCATCGTTTTCGTCGTCTCCTCCATTGCTGGCTATGATGATGCCTTTGAGCTACTGGGAGCCTATGGGAGCCTATTCCGTCAGCAAGACAAGACCGCGCTGATTGGCTTGACCACTGGCTCCAGGAGTCATCAGGACAAAAATACCCATGGGTCGTCTGGGCACTGGTCTCCTTTTTGGTCTCCGAGGAGTCTCCGAGGATGCGGGCTACATTA

Full Affymetrix probeset data:

Annotations for 1640492_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720