FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640493_at:

>probe:Drosophila_2:1640493_at:246:427; Interrogation_Position=1011; Antisense; GAGATCTGTGACCAGTGGTTCCTGC
>probe:Drosophila_2:1640493_at:478:173; Interrogation_Position=1060; Antisense; AAAGCACTAAATTACACCAGCGAAG
>probe:Drosophila_2:1640493_at:585:357; Interrogation_Position=652; Antisense; GCAACTCCAAGTCCTGGTTCTGTGA
>probe:Drosophila_2:1640493_at:554:715; Interrogation_Position=669; Antisense; TTCTGTGACCAGTGCGGCGGCGTCT
>probe:Drosophila_2:1640493_at:546:493; Interrogation_Position=739; Antisense; GTCACAAACCGTTCGCGTGCGACAT
>probe:Drosophila_2:1640493_at:381:627; Interrogation_Position=765; Antisense; TGCCAGGCCAAGTACTACACGGATA
>probe:Drosophila_2:1640493_at:466:141; Interrogation_Position=783; Antisense; ACGGATAACGAGATGCGGCGCCACA
>probe:Drosophila_2:1640493_at:321:109; Interrogation_Position=807; Antisense; AGAATCCTTCACACGGACGCCAGAC
>probe:Drosophila_2:1640493_at:562:487; Interrogation_Position=833; Antisense; GTACGCTTGTCGGTTCTGTAGCAAG
>probe:Drosophila_2:1640493_at:386:213; Interrogation_Position=855; Antisense; AAGACCTACCGAGGATGCAGCAGTA
>probe:Drosophila_2:1640493_at:50:447; Interrogation_Position=868; Antisense; GATGCAGCAGTAAAGTGGTCCACGA
>probe:Drosophila_2:1640493_at:287:87; Interrogation_Position=922; Antisense; AGTGCCAGCATTGCGACAAGGCCTT
>probe:Drosophila_2:1640493_at:106:427; Interrogation_Position=975; Antisense; GAGATGCTGCACACTAATCAGCGGA
>probe:Drosophila_2:1640493_at:140:331; Interrogation_Position=995; Antisense; GCGGAAGTACCACTGCGAGATCTGT

Paste this into a BLAST search page for me
GAGATCTGTGACCAGTGGTTCCTGCAAAGCACTAAATTACACCAGCGAAGGCAACTCCAAGTCCTGGTTCTGTGATTCTGTGACCAGTGCGGCGGCGTCTGTCACAAACCGTTCGCGTGCGACATTGCCAGGCCAAGTACTACACGGATAACGGATAACGAGATGCGGCGCCACAAGAATCCTTCACACGGACGCCAGACGTACGCTTGTCGGTTCTGTAGCAAGAAGACCTACCGAGGATGCAGCAGTAGATGCAGCAGTAAAGTGGTCCACGAAGTGCCAGCATTGCGACAAGGCCTTGAGATGCTGCACACTAATCAGCGGAGCGGAAGTACCACTGCGAGATCTGT

Full Affymetrix probeset data:

Annotations for 1640493_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720