Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640494_at:

>probe:Drosophila_2:1640494_at:35:205; Interrogation_Position=1960; Antisense; AAGCCAAGCGGTGTAAACGATCTGC
>probe:Drosophila_2:1640494_at:264:199; Interrogation_Position=1975; Antisense; AACGATCTGCTTAGTCTACTGGACA
>probe:Drosophila_2:1640494_at:268:559; Interrogation_Position=1995; Antisense; GGACAATATGTTTGCCGATGCCCAA
>probe:Drosophila_2:1640494_at:452:99; Interrogation_Position=2021; Antisense; AGATGGGCTCATCCACTGATTTACC
>probe:Drosophila_2:1640494_at:237:111; Interrogation_Position=2052; Antisense; AGCAAGTTCTACTACCAGCACTGTG
>probe:Drosophila_2:1640494_at:427:285; Interrogation_Position=2077; Antisense; CTGAGGCCAGTTAGCACCAAGTTGT
>probe:Drosophila_2:1640494_at:677:675; Interrogation_Position=2088; Antisense; TAGCACCAAGTTGTTGCCGCAGCAA
>probe:Drosophila_2:1640494_at:589:297; Interrogation_Position=2105; Antisense; CGCAGCAACCGGAACCTAGGATATC
>probe:Drosophila_2:1640494_at:656:523; Interrogation_Position=2138; Antisense; GGGCGGGCATAGAGAGTCTCCTTAA
>probe:Drosophila_2:1640494_at:454:529; Interrogation_Position=2203; Antisense; GGGTCAACGATTTCCACTGAAACAC
>probe:Drosophila_2:1640494_at:191:281; Interrogation_Position=2231; Antisense; CTCGGGCAACACGTCAGGTATTTGA
>probe:Drosophila_2:1640494_at:381:605; Interrogation_Position=2259; Antisense; TGATCAATTGCCTGAGTCACGGATT
>probe:Drosophila_2:1640494_at:127:531; Interrogation_Position=2291; Antisense; GGGTCACCACCAGTGATGATATTAT
>probe:Drosophila_2:1640494_at:184:149; Interrogation_Position=2477; Antisense; ACTTGGAGGATCTTATCGAGGGTCT

Paste this into a BLAST search page for me
AAGCCAAGCGGTGTAAACGATCTGCAACGATCTGCTTAGTCTACTGGACAGGACAATATGTTTGCCGATGCCCAAAGATGGGCTCATCCACTGATTTACCAGCAAGTTCTACTACCAGCACTGTGCTGAGGCCAGTTAGCACCAAGTTGTTAGCACCAAGTTGTTGCCGCAGCAACGCAGCAACCGGAACCTAGGATATCGGGCGGGCATAGAGAGTCTCCTTAAGGGTCAACGATTTCCACTGAAACACCTCGGGCAACACGTCAGGTATTTGATGATCAATTGCCTGAGTCACGGATTGGGTCACCACCAGTGATGATATTATACTTGGAGGATCTTATCGAGGGTCT

Full Affymetrix probeset data:

Annotations for 1640494_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime