FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640495_at:

>probe:Drosophila_2:1640495_at:627:431; Interrogation_Position=1377; Antisense; GAGGACGACCTTAGCAACGGACCGC
>probe:Drosophila_2:1640495_at:616:293; Interrogation_Position=1465; Antisense; CGAGCAGCAAGGTCATCGCCAGCAG
>probe:Drosophila_2:1640495_at:85:235; Interrogation_Position=1494; Antisense; AATGCCAATAAATCTCGCTCGGCCA
>probe:Drosophila_2:1640495_at:8:255; Interrogation_Position=1522; Antisense; CAACGCTCTCGACGGATGCCAGCAA
>probe:Drosophila_2:1640495_at:395:99; Interrogation_Position=1552; Antisense; AGATGAACAGCTTACCCAGCGATCT
>probe:Drosophila_2:1640495_at:585:381; Interrogation_Position=1631; Antisense; GAACGAGATTAGCACATCGCTGCCC
>probe:Drosophila_2:1640495_at:603:149; Interrogation_Position=1656; Antisense; ACTTCCTTCTCTGGCGGCAAAGTAG
>probe:Drosophila_2:1640495_at:99:89; Interrogation_Position=1676; Antisense; AGTAGAGGACTACGGCATCACCGAG
>probe:Drosophila_2:1640495_at:191:331; Interrogation_Position=1704; Antisense; GCGGTGCGTCGGTATCTTAAGCGAA
>probe:Drosophila_2:1640495_at:453:481; Interrogation_Position=1715; Antisense; GTATCTTAAGCGAAAGCCCCTGACC
>probe:Drosophila_2:1640495_at:601:159; Interrogation_Position=1768; Antisense; ACAAGAAGACGCCTGTCTCCAGCGA
>probe:Drosophila_2:1640495_at:145:377; Interrogation_Position=1823; Antisense; GAAGAAGATCAATCCCGTCAAGCAC
>probe:Drosophila_2:1640495_at:348:483; Interrogation_Position=1865; Antisense; GTATCTCTGGATCAAGTAGCCCGCA
>probe:Drosophila_2:1640495_at:9:219; Interrogation_Position=1878; Antisense; AAGTAGCCCGCAGTCATGTGATTTT

Paste this into a BLAST search page for me
GAGGACGACCTTAGCAACGGACCGCCGAGCAGCAAGGTCATCGCCAGCAGAATGCCAATAAATCTCGCTCGGCCACAACGCTCTCGACGGATGCCAGCAAAGATGAACAGCTTACCCAGCGATCTGAACGAGATTAGCACATCGCTGCCCACTTCCTTCTCTGGCGGCAAAGTAGAGTAGAGGACTACGGCATCACCGAGGCGGTGCGTCGGTATCTTAAGCGAAGTATCTTAAGCGAAAGCCCCTGACCACAAGAAGACGCCTGTCTCCAGCGAGAAGAAGATCAATCCCGTCAAGCACGTATCTCTGGATCAAGTAGCCCGCAAAGTAGCCCGCAGTCATGTGATTTT

Full Affymetrix probeset data:

Annotations for 1640495_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720