FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640496_at:

>probe:Drosophila_2:1640496_at:682:725; Interrogation_Position=3615; Antisense; TTGATGGGCTTCGATGTTCATTCCG
>probe:Drosophila_2:1640496_at:51:473; Interrogation_Position=3630; Antisense; GTTCATTCCGCATTAGTTGTTGTCA
>probe:Drosophila_2:1640496_at:245:233; Interrogation_Position=3717; Antisense; AATGCTGTTTCGTTGGTGAATCTCG
>probe:Drosophila_2:1640496_at:111:511; Interrogation_Position=3732; Antisense; GTGAATCTCGTCATGGCCGTCGGCA
>probe:Drosophila_2:1640496_at:110:319; Interrogation_Position=3747; Antisense; GCCGTCGGCATATCCGTGGAATTTT
>probe:Drosophila_2:1640496_at:101:585; Interrogation_Position=3763; Antisense; TGGAATTTTGTTCGCACTTGGTGCA
>probe:Drosophila_2:1640496_at:554:43; Interrogation_Position=3823; Antisense; ATCGAGCTGCAGATAGCCTTTCCAA
>probe:Drosophila_2:1640496_at:132:65; Interrogation_Position=3849; Antisense; ATGGGTAGCTCCATTTTCTCCGGAA
>probe:Drosophila_2:1640496_at:691:569; Interrogation_Position=3894; Antisense; GGCATACTAGTGTTAGCCTTTGCAA
>probe:Drosophila_2:1640496_at:33:447; Interrogation_Position=3926; Antisense; GATATTCCAGGTGTTTTATTTCCGT
>probe:Drosophila_2:1640496_at:40:37; Interrogation_Position=3993; Antisense; ATCTTTCTGCCCGTTCTATTAAGTT
>probe:Drosophila_2:1640496_at:631:521; Interrogation_Position=4024; Antisense; GGGCTCCTGTAAGTAATGCTAGATT
>probe:Drosophila_2:1640496_at:626:13; Interrogation_Position=4046; Antisense; ATTAAGGTATCATAGCCAGGCGGCT
>probe:Drosophila_2:1640496_at:479:421; Interrogation_Position=4074; Antisense; GAGCACGAGACAGCACTAGCGGGAA

Paste this into a BLAST search page for me
TTGATGGGCTTCGATGTTCATTCCGGTTCATTCCGCATTAGTTGTTGTCAAATGCTGTTTCGTTGGTGAATCTCGGTGAATCTCGTCATGGCCGTCGGCAGCCGTCGGCATATCCGTGGAATTTTTGGAATTTTGTTCGCACTTGGTGCAATCGAGCTGCAGATAGCCTTTCCAAATGGGTAGCTCCATTTTCTCCGGAAGGCATACTAGTGTTAGCCTTTGCAAGATATTCCAGGTGTTTTATTTCCGTATCTTTCTGCCCGTTCTATTAAGTTGGGCTCCTGTAAGTAATGCTAGATTATTAAGGTATCATAGCCAGGCGGCTGAGCACGAGACAGCACTAGCGGGAA

Full Affymetrix probeset data:

Annotations for 1640496_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720