FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640497_at:

>probe:Drosophila_2:1640497_at:457:429; Interrogation_Position=3526; Antisense; GAGTTTGAGGAGTCGCACTTCTGCG
>probe:Drosophila_2:1640497_at:659:297; Interrogation_Position=3539; Antisense; CGCACTTCTGCGGTATTTGCATGGA
>probe:Drosophila_2:1640497_at:499:179; Interrogation_Position=3567; Antisense; AAAAAGGGATGTGGCCTTCCTGTGC
>probe:Drosophila_2:1640497_at:225:5; Interrogation_Position=3611; Antisense; ATTGTGCCGAAACGCTCCGCACATG
>probe:Drosophila_2:1640497_at:257:153; Interrogation_Position=3631; Antisense; ACATGCCACATGTGTCGCAAGACAA
>probe:Drosophila_2:1640497_at:345:453; Interrogation_Position=3666; Antisense; GATCAACCTGTACTGAACGGCGGTA
>probe:Drosophila_2:1640497_at:709:157; Interrogation_Position=3782; Antisense; ACACACTCACATTGCCGTGTCATGT
>probe:Drosophila_2:1640497_at:80:317; Interrogation_Position=3795; Antisense; GCCGTGTCATGTGCAAATCGAAATT
>probe:Drosophila_2:1640497_at:462:653; Interrogation_Position=3860; Antisense; TAATCGGTTCATCATCGGCATCGTC
>probe:Drosophila_2:1640497_at:671:569; Interrogation_Position=3876; Antisense; GGCATCGTCGCAACACGCAACAAAT
>probe:Drosophila_2:1640497_at:714:245; Interrogation_Position=3898; Antisense; AATTAATGTGCACCTTCTCGTGTCT
>probe:Drosophila_2:1640497_at:528:641; Interrogation_Position=3913; Antisense; TCTCGTGTCTAGTTATTAGCCCCGT
>probe:Drosophila_2:1640497_at:64:675; Interrogation_Position=3929; Antisense; TAGCCCCGTTTAACCATGTCTGGTA
>probe:Drosophila_2:1640497_at:360:237; Interrogation_Position=4052; Antisense; AATCGATGTCGGTGGTTAGCCTACA

Paste this into a BLAST search page for me
GAGTTTGAGGAGTCGCACTTCTGCGCGCACTTCTGCGGTATTTGCATGGAAAAAAGGGATGTGGCCTTCCTGTGCATTGTGCCGAAACGCTCCGCACATGACATGCCACATGTGTCGCAAGACAAGATCAACCTGTACTGAACGGCGGTAACACACTCACATTGCCGTGTCATGTGCCGTGTCATGTGCAAATCGAAATTTAATCGGTTCATCATCGGCATCGTCGGCATCGTCGCAACACGCAACAAATAATTAATGTGCACCTTCTCGTGTCTTCTCGTGTCTAGTTATTAGCCCCGTTAGCCCCGTTTAACCATGTCTGGTAAATCGATGTCGGTGGTTAGCCTACA

Full Affymetrix probeset data:

Annotations for 1640497_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720