FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640499_at:

>probe:Drosophila_2:1640499_at:151:421; Interrogation_Position=283; Antisense; GAGCAGGCACGCGTCAGTGTACACA
>probe:Drosophila_2:1640499_at:167:85; Interrogation_Position=298; Antisense; AGTGTACACACTACGCTACTGGGAA
>probe:Drosophila_2:1640499_at:500:75; Interrogation_Position=380; Antisense; AGGAGGACGCCGAGCCGTACATCTT
>probe:Drosophila_2:1640499_at:455:349; Interrogation_Position=423; Antisense; GCAGGACCGCATCGAGGATCTGTTA
>probe:Drosophila_2:1640499_at:727:599; Interrogation_Position=443; Antisense; TGTTAAAACGACCAGCTTCCGAGTT
>probe:Drosophila_2:1640499_at:520:349; Interrogation_Position=477; Antisense; GCAGGTAGCATCATCAGACCCGCAA
>probe:Drosophila_2:1640499_at:727:125; Interrogation_Position=503; Antisense; AGCCACCAGCTACGGAACTTCAGAG
>probe:Drosophila_2:1640499_at:220:71; Interrogation_Position=587; Antisense; AGGCCCGACAGTTGGAGCTCACAGG
>probe:Drosophila_2:1640499_at:89:335; Interrogation_Position=603; Antisense; GCTCACAGGATTCAGTAGACCCGGT
>probe:Drosophila_2:1640499_at:242:491; Interrogation_Position=667; Antisense; GTACAGGAATTCTGGCGCACCATCA
>probe:Drosophila_2:1640499_at:382:227; Interrogation_Position=691; Antisense; AAGGCCCTGCGCTGGCAGAAGATCA
>probe:Drosophila_2:1640499_at:623:437; Interrogation_Position=757; Antisense; GAGGACTTCAGCGAACAGCTTTTTA
>probe:Drosophila_2:1640499_at:410:189; Interrogation_Position=802; Antisense; AACATGGGCCAGTTCATTCGATTCC
>probe:Drosophila_2:1640499_at:526:379; Interrogation_Position=829; Antisense; GAAGCCCACGGATTTGGCTACATGA

Paste this into a BLAST search page for me
GAGCAGGCACGCGTCAGTGTACACAAGTGTACACACTACGCTACTGGGAAAGGAGGACGCCGAGCCGTACATCTTGCAGGACCGCATCGAGGATCTGTTATGTTAAAACGACCAGCTTCCGAGTTGCAGGTAGCATCATCAGACCCGCAAAGCCACCAGCTACGGAACTTCAGAGAGGCCCGACAGTTGGAGCTCACAGGGCTCACAGGATTCAGTAGACCCGGTGTACAGGAATTCTGGCGCACCATCAAAGGCCCTGCGCTGGCAGAAGATCAGAGGACTTCAGCGAACAGCTTTTTAAACATGGGCCAGTTCATTCGATTCCGAAGCCCACGGATTTGGCTACATGA

Full Affymetrix probeset data:

Annotations for 1640499_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720