Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640500_at:

>probe:Drosophila_2:1640500_at:544:649; Interrogation_Position=14; Antisense; TCACAAACCAATTGGCCATCTACCA
>probe:Drosophila_2:1640500_at:319:579; Interrogation_Position=27; Antisense; GGCCATCTACCAAGTGACAATCCAA
>probe:Drosophila_2:1640500_at:226:681; Interrogation_Position=403; Antisense; TATGTGGCTCGTCCCTATGTCGCCG
>probe:Drosophila_2:1640500_at:438:283; Interrogation_Position=445; Antisense; CTGCTGAAGAAGTAAATCCATGGAT
>probe:Drosophila_2:1640500_at:14:167; Interrogation_Position=458; Antisense; AAATCCATGGATTGTAAACCCTGCG
>probe:Drosophila_2:1640500_at:312:175; Interrogation_Position=473; Antisense; AAACCCTGCGGAAGATATTGCCCCA
>probe:Drosophila_2:1640500_at:525:215; Interrogation_Position=484; Antisense; AAGATATTGCCCCATGAGCTTGGCT
>probe:Drosophila_2:1640500_at:471:609; Interrogation_Position=498; Antisense; TGAGCTTGGCTCATGGACTGGCATT
>probe:Drosophila_2:1640500_at:210:573; Interrogation_Position=505; Antisense; GGCTCATGGACTGGCATTTATTTTC
>probe:Drosophila_2:1640500_at:154:15; Interrogation_Position=520; Antisense; ATTTATTTTCCATGCAACCCCTACT
>probe:Drosophila_2:1640500_at:241:359; Interrogation_Position=533; Antisense; GCAACCCCTACTTGTGATGCATTAA
>probe:Drosophila_2:1640500_at:545:273; Interrogation_Position=543; Antisense; CTTGTGATGCATTAAACCGTTTAGA
>probe:Drosophila_2:1640500_at:602:33; Interrogation_Position=67; Antisense; ATCAACATGTTCAAATTCGCTGCTA
>probe:Drosophila_2:1640500_at:144:713; Interrogation_Position=76; Antisense; TTCAAATTCGCTGCTATCTTCTTCG

Paste this into a BLAST search page for me
TCACAAACCAATTGGCCATCTACCAGGCCATCTACCAAGTGACAATCCAATATGTGGCTCGTCCCTATGTCGCCGCTGCTGAAGAAGTAAATCCATGGATAAATCCATGGATTGTAAACCCTGCGAAACCCTGCGGAAGATATTGCCCCAAAGATATTGCCCCATGAGCTTGGCTTGAGCTTGGCTCATGGACTGGCATTGGCTCATGGACTGGCATTTATTTTCATTTATTTTCCATGCAACCCCTACTGCAACCCCTACTTGTGATGCATTAACTTGTGATGCATTAAACCGTTTAGAATCAACATGTTCAAATTCGCTGCTATTCAAATTCGCTGCTATCTTCTTCG

Full Affymetrix probeset data:

Annotations for 1640500_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime