FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640501_at:

>probe:Drosophila_2:1640501_at:329:329; Interrogation_Position=2662; Antisense; GCGTCCCGTGTCCAGATAAACATAA
>probe:Drosophila_2:1640501_at:489:655; Interrogation_Position=2684; Antisense; TAATGCTGGACAAGACGCCGATATT
>probe:Drosophila_2:1640501_at:282:147; Interrogation_Position=2737; Antisense; ACTACCATCCTTCCACTTATGTGGA
>probe:Drosophila_2:1640501_at:665:449; Interrogation_Position=2760; Antisense; GATCGAGATCACGTCGGGAGACTTT
>probe:Drosophila_2:1640501_at:629:423; Interrogation_Position=2777; Antisense; GAGACTTTTCCGAGGAGGTGCTCCA
>probe:Drosophila_2:1640501_at:318:79; Interrogation_Position=2792; Antisense; AGGTGCTCCACACGCTGTACTTAAG
>probe:Drosophila_2:1640501_at:314:489; Interrogation_Position=2808; Antisense; GTACTTAAGCACCTTTGGCCTGAAT
>probe:Drosophila_2:1640501_at:4:359; Interrogation_Position=2841; Antisense; GCAAACTCTTAAATACGGCACCCTG
>probe:Drosophila_2:1640501_at:300:23; Interrogation_Position=2869; Antisense; ATATCGGTGACATCGTTCAGCCTGA
>probe:Drosophila_2:1640501_at:684:673; Interrogation_Position=2897; Antisense; TAGCCGGCGTCTATTACCTGAACAG
>probe:Drosophila_2:1640501_at:454:423; Interrogation_Position=2986; Antisense; GAGAACGTCATCGTTGTGCACCACA
>probe:Drosophila_2:1640501_at:293:597; Interrogation_Position=3000; Antisense; TGTGCACCACATTGACATGCCCGTT
>probe:Drosophila_2:1640501_at:113:683; Interrogation_Position=3169; Antisense; TATAGTCGCCAGTTACCTTTAGTCT
>probe:Drosophila_2:1640501_at:197:129; Interrogation_Position=3183; Antisense; ACCTTTAGTCTTTAGTCATCTGATG

Paste this into a BLAST search page for me
GCGTCCCGTGTCCAGATAAACATAATAATGCTGGACAAGACGCCGATATTACTACCATCCTTCCACTTATGTGGAGATCGAGATCACGTCGGGAGACTTTGAGACTTTTCCGAGGAGGTGCTCCAAGGTGCTCCACACGCTGTACTTAAGGTACTTAAGCACCTTTGGCCTGAATGCAAACTCTTAAATACGGCACCCTGATATCGGTGACATCGTTCAGCCTGATAGCCGGCGTCTATTACCTGAACAGGAGAACGTCATCGTTGTGCACCACATGTGCACCACATTGACATGCCCGTTTATAGTCGCCAGTTACCTTTAGTCTACCTTTAGTCTTTAGTCATCTGATG

Full Affymetrix probeset data:

Annotations for 1640501_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720