FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640505_at:

>probe:Drosophila_2:1640505_at:721:143; Interrogation_Position=130; Antisense; ACTGATCCTGATCCAGAACCTGACA
>probe:Drosophila_2:1640505_at:173:437; Interrogation_Position=232; Antisense; GAGGATAGTTGCAGCTCCAGTGGCA
>probe:Drosophila_2:1640505_at:555:529; Interrogation_Position=268; Antisense; GGGATAACTGTCTACCAGGCCGATG
>probe:Drosophila_2:1640505_at:301:269; Interrogation_Position=283; Antisense; CAGGCCGATGAAACCCAGCCAGATA
>probe:Drosophila_2:1640505_at:537:385; Interrogation_Position=316; Antisense; GAACAGATCCTTGAGATTGCCGCCA
>probe:Drosophila_2:1640505_at:204:465; Interrogation_Position=330; Antisense; GATTGCCGCCACGTTAACTGATTCA
>probe:Drosophila_2:1640505_at:400:37; Interrogation_Position=356; Antisense; ATCTATCCAACTATCCCACTGTTGA
>probe:Drosophila_2:1640505_at:118:403; Interrogation_Position=409; Antisense; GACATATTCTATAGCCCTATTGCCC
>probe:Drosophila_2:1640505_at:317:425; Interrogation_Position=505; Antisense; GAGACCGAGAAAACTCAGCCCCAAA
>probe:Drosophila_2:1640505_at:13:561; Interrogation_Position=53; Antisense; GGAAATCTTCGCCAGGACACATGAG
>probe:Drosophila_2:1640505_at:709:703; Interrogation_Position=603; Antisense; TTATCGTGGACGCAATCGGCGCTAG
>probe:Drosophila_2:1640505_at:321:399; Interrogation_Position=68; Antisense; GACACATGAGCGCAGCCGTGATGAA
>probe:Drosophila_2:1640505_at:521:317; Interrogation_Position=82; Antisense; GCCGTGATGAATACCCGACTGTACA
>probe:Drosophila_2:1640505_at:504:405; Interrogation_Position=98; Antisense; GACTGTACAACAATACTGCCGCTGC

Paste this into a BLAST search page for me
ACTGATCCTGATCCAGAACCTGACAGAGGATAGTTGCAGCTCCAGTGGCAGGGATAACTGTCTACCAGGCCGATGCAGGCCGATGAAACCCAGCCAGATAGAACAGATCCTTGAGATTGCCGCCAGATTGCCGCCACGTTAACTGATTCAATCTATCCAACTATCCCACTGTTGAGACATATTCTATAGCCCTATTGCCCGAGACCGAGAAAACTCAGCCCCAAAGGAAATCTTCGCCAGGACACATGAGTTATCGTGGACGCAATCGGCGCTAGGACACATGAGCGCAGCCGTGATGAAGCCGTGATGAATACCCGACTGTACAGACTGTACAACAATACTGCCGCTGC

Full Affymetrix probeset data:

Annotations for 1640505_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720