Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640507_s_at:

>probe:Drosophila_2:1640507_s_at:186:481; Interrogation_Position=146; Antisense; GTATTTGGGCGTTATGACCCCGGCA
>probe:Drosophila_2:1640507_s_at:570:33; Interrogation_Position=178; Antisense; ATCAAGCTCCTAGTCATCGGGACAG
>probe:Drosophila_2:1640507_s_at:236:341; Interrogation_Position=229; Antisense; GCATAGCACAAATCGCTGACGTCCT
>probe:Drosophila_2:1640507_s_at:482:611; Interrogation_Position=245; Antisense; TGACGTCCTGCATGGATTTCCGATA
>probe:Drosophila_2:1640507_s_at:179:589; Interrogation_Position=257; Antisense; TGGATTTCCGATACACCGACACTTA
>probe:Drosophila_2:1640507_s_at:489:707; Interrogation_Position=279; Antisense; TTACCGTCTATGTGTGCGCTTCAAT
>probe:Drosophila_2:1640507_s_at:671:163; Interrogation_Position=31; Antisense; AAATATCTCACATTGTGCCCGGGCA
>probe:Drosophila_2:1640507_s_at:115:113; Interrogation_Position=356; Antisense; AGCAGTCTGGGCACTCAGGCAACCA
>probe:Drosophila_2:1640507_s_at:336:203; Interrogation_Position=376; Antisense; AACCAGCCGCCTCGTGGAATGGAAT
>probe:Drosophila_2:1640507_s_at:657:535; Interrogation_Position=438; Antisense; GGTCCAGTCTGGTGGTGGCTCAAAT
>probe:Drosophila_2:1640507_s_at:307:625; Interrogation_Position=46; Antisense; TGCCCGGGCAATTGACCCATGCAAT
>probe:Drosophila_2:1640507_s_at:247:513; Interrogation_Position=538; Antisense; GTGATGGAAATTCTTCCGAGCCTTC
>probe:Drosophila_2:1640507_s_at:435:125; Interrogation_Position=556; Antisense; AGCCTTCGAGGCCTTAATAAATTTG
>probe:Drosophila_2:1640507_s_at:415:675; Interrogation_Position=77; Antisense; TATAGACTTCAGCAACACCGGTTAA

Paste this into a BLAST search page for me
GTATTTGGGCGTTATGACCCCGGCAATCAAGCTCCTAGTCATCGGGACAGGCATAGCACAAATCGCTGACGTCCTTGACGTCCTGCATGGATTTCCGATATGGATTTCCGATACACCGACACTTATTACCGTCTATGTGTGCGCTTCAATAAATATCTCACATTGTGCCCGGGCAAGCAGTCTGGGCACTCAGGCAACCAAACCAGCCGCCTCGTGGAATGGAATGGTCCAGTCTGGTGGTGGCTCAAATTGCCCGGGCAATTGACCCATGCAATGTGATGGAAATTCTTCCGAGCCTTCAGCCTTCGAGGCCTTAATAAATTTGTATAGACTTCAGCAACACCGGTTAA

Full Affymetrix probeset data:

Annotations for 1640507_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime