FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640511_at:

>probe:Drosophila_2:1640511_at:707:409; Interrogation_Position=124; Antisense; GACGACATATTTTTCCTGATCTATC
>probe:Drosophila_2:1640511_at:283:73; Interrogation_Position=152; Antisense; AGGCACATACTTTGTTCCAGGCAGG
>probe:Drosophila_2:1640511_at:44:575; Interrogation_Position=191; Antisense; GGCGTATGCGTTATCACGATGCACA
>probe:Drosophila_2:1640511_at:398:349; Interrogation_Position=263; Antisense; GCAGTTTCGAACAGCAGTGCCGTAA
>probe:Drosophila_2:1640511_at:266:215; Interrogation_Position=290; Antisense; AAGATATGCTTATCGCCCTTTTCGA
>probe:Drosophila_2:1640511_at:74:215; Interrogation_Position=337; Antisense; AAGATGAGGCAGTCCAGGTGCGTCT
>probe:Drosophila_2:1640511_at:48:81; Interrogation_Position=352; Antisense; AGGTGCGTCTGCTATGTCATGAAGG
>probe:Drosophila_2:1640511_at:586:53; Interrogation_Position=370; Antisense; ATGAAGGAACTTCGTCTCCTGACCA
>probe:Drosophila_2:1640511_at:403:609; Interrogation_Position=389; Antisense; TGACCATCAATAATCCTTCGGCTTT
>probe:Drosophila_2:1640511_at:536:495; Interrogation_Position=431; Antisense; GTCGTGCCCTAAGCGACTTGGGTAA
>probe:Drosophila_2:1640511_at:151:49; Interrogation_Position=461; Antisense; ATCCATCCCGTTTGTGCTACATAAA
>probe:Drosophila_2:1640511_at:351:381; Interrogation_Position=51; Antisense; GAACGATAAGTTCTCGACCCATGCC
>probe:Drosophila_2:1640511_at:497:457; Interrogation_Position=565; Antisense; GATACCAATCAGATGCTTTCTCAGC
>probe:Drosophila_2:1640511_at:644:197; Interrogation_Position=94; Antisense; AACGACCAATCACTAAGCTCCGATG

Paste this into a BLAST search page for me
GACGACATATTTTTCCTGATCTATCAGGCACATACTTTGTTCCAGGCAGGGGCGTATGCGTTATCACGATGCACAGCAGTTTCGAACAGCAGTGCCGTAAAAGATATGCTTATCGCCCTTTTCGAAAGATGAGGCAGTCCAGGTGCGTCTAGGTGCGTCTGCTATGTCATGAAGGATGAAGGAACTTCGTCTCCTGACCATGACCATCAATAATCCTTCGGCTTTGTCGTGCCCTAAGCGACTTGGGTAAATCCATCCCGTTTGTGCTACATAAAGAACGATAAGTTCTCGACCCATGCCGATACCAATCAGATGCTTTCTCAGCAACGACCAATCACTAAGCTCCGATG

Full Affymetrix probeset data:

Annotations for 1640511_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720