FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640512_at:

>probe:Drosophila_2:1640512_at:565:67; Interrogation_Position=1002; Antisense; ATGGCCCGAATCAACTGCGAGGAGT
>probe:Drosophila_2:1640512_at:212:429; Interrogation_Position=1023; Antisense; GAGTTCTACGAAGTCTACCGCGGAG
>probe:Drosophila_2:1640512_at:96:433; Interrogation_Position=1045; Antisense; GAGTGGTGCCCGAGTATATACCCAT
>probe:Drosophila_2:1640512_at:703:27; Interrogation_Position=1062; Antisense; ATACCCATGGTTGCTCAGTTGGCCA
>probe:Drosophila_2:1640512_at:73:509; Interrogation_Position=1100; Antisense; GTGCATGGAGATTGCTTGCGCCGAT
>probe:Drosophila_2:1640512_at:383:341; Interrogation_Position=1113; Antisense; GCTTGCGCCGATCCCGAAAAGAAAA
>probe:Drosophila_2:1640512_at:112:715; Interrogation_Position=1158; Antisense; TTCTGTGGACCCATGGATCCGGAGA
>probe:Drosophila_2:1640512_at:545:217; Interrogation_Position=1227; Antisense; AAGTCCAAGGTGCAGAACGCCGTCC
>probe:Drosophila_2:1640512_at:683:59; Interrogation_Position=1353; Antisense; ATGTTTGCCTGTGTGCGTTTATCAA
>probe:Drosophila_2:1640512_at:320:713; Interrogation_Position=898; Antisense; TTGCCATCATTAAGCCGCACAGCAT
>probe:Drosophila_2:1640512_at:728:497; Interrogation_Position=931; Antisense; GTCTCCTGGGAGACATCATTTCCGA
>probe:Drosophila_2:1640512_at:303:673; Interrogation_Position=950; Antisense; TTCCGAAATCCTGTCGAATGGCTTT
>probe:Drosophila_2:1640512_at:47:697; Interrogation_Position=972; Antisense; TTTCGGTTGACAGCCATGCGCATGA
>probe:Drosophila_2:1640512_at:340:49; Interrogation_Position=987; Antisense; ATGCGCATGATTCTAATGGCCCGAA

Paste this into a BLAST search page for me
ATGGCCCGAATCAACTGCGAGGAGTGAGTTCTACGAAGTCTACCGCGGAGGAGTGGTGCCCGAGTATATACCCATATACCCATGGTTGCTCAGTTGGCCAGTGCATGGAGATTGCTTGCGCCGATGCTTGCGCCGATCCCGAAAAGAAAATTCTGTGGACCCATGGATCCGGAGAAAGTCCAAGGTGCAGAACGCCGTCCATGTTTGCCTGTGTGCGTTTATCAATTGCCATCATTAAGCCGCACAGCATGTCTCCTGGGAGACATCATTTCCGATTCCGAAATCCTGTCGAATGGCTTTTTTCGGTTGACAGCCATGCGCATGAATGCGCATGATTCTAATGGCCCGAA

Full Affymetrix probeset data:

Annotations for 1640512_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720