FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640516_at:

>probe:Drosophila_2:1640516_at:657:693; Interrogation_Position=103; Antisense; TTTGCATCTTCCACCGGAAACGATA
>probe:Drosophila_2:1640516_at:369:191; Interrogation_Position=142; Antisense; AACATTCAGAATTCGGCCAGTGGAC
>probe:Drosophila_2:1640516_at:543:579; Interrogation_Position=156; Antisense; GGCCAGTGGACGACCTGTGGATTAT
>probe:Drosophila_2:1640516_at:611:423; Interrogation_Position=17; Antisense; GAGACGACAACCAGCGATTCCAATT
>probe:Drosophila_2:1640516_at:154:461; Interrogation_Position=175; Antisense; GATTATCACACGGTGGTGGGCCACT
>probe:Drosophila_2:1640516_at:397:523; Interrogation_Position=192; Antisense; GGGCCACTTCAAGGACTTCTTCATG
>probe:Drosophila_2:1640516_at:313:711; Interrogation_Position=208; Antisense; TTCTTCATGTACCTGCCGGTGATGA
>probe:Drosophila_2:1640516_at:468:369; Interrogation_Position=243; Antisense; GAAGGAGACGATGTCAGGATTCCCC
>probe:Drosophila_2:1640516_at:481:51; Interrogation_Position=283; Antisense; ATGCGCATCCTGACTTCTGGCAAAG
>probe:Drosophila_2:1640516_at:485:463; Interrogation_Position=32; Antisense; GATTCCAATTCCAACTGCAGGCAGT
>probe:Drosophila_2:1640516_at:42:121; Interrogation_Position=355; Antisense; AGCGGCGAACTCTTGGACACCAATT
>probe:Drosophila_2:1640516_at:338:557; Interrogation_Position=369; Antisense; GGACACCAATTCTCGCTTCGGTTGA
>probe:Drosophila_2:1640516_at:228:269; Interrogation_Position=49; Antisense; CAGGCAGTGGCAACAGTTTTCTTGT
>probe:Drosophila_2:1640516_at:484:723; Interrogation_Position=70; Antisense; TTGTTGGTTTCACAGCTTTGCTTTG

Paste this into a BLAST search page for me
TTTGCATCTTCCACCGGAAACGATAAACATTCAGAATTCGGCCAGTGGACGGCCAGTGGACGACCTGTGGATTATGAGACGACAACCAGCGATTCCAATTGATTATCACACGGTGGTGGGCCACTGGGCCACTTCAAGGACTTCTTCATGTTCTTCATGTACCTGCCGGTGATGAGAAGGAGACGATGTCAGGATTCCCCATGCGCATCCTGACTTCTGGCAAAGGATTCCAATTCCAACTGCAGGCAGTAGCGGCGAACTCTTGGACACCAATTGGACACCAATTCTCGCTTCGGTTGACAGGCAGTGGCAACAGTTTTCTTGTTTGTTGGTTTCACAGCTTTGCTTTG

Full Affymetrix probeset data:

Annotations for 1640516_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720