FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640518_at:

>probe:Drosophila_2:1640518_at:24:469; Interrogation_Position=115; Antisense; GTTGACAATGAAGCTGGCGACGCAT
>probe:Drosophila_2:1640518_at:149:411; Interrogation_Position=133; Antisense; GACGCATGCGCGCAGACTAATTGTC
>probe:Drosophila_2:1640518_at:288:71; Interrogation_Position=180; Antisense; AGGCGAGGAACACTCCTTTACACAT
>probe:Drosophila_2:1640518_at:563:143; Interrogation_Position=191; Antisense; ACTCCTTTACACATATCGCTGTTGG
>probe:Drosophila_2:1640518_at:185:467; Interrogation_Position=211; Antisense; GTTGGAGGAGCGTATATAGCTGCAA
>probe:Drosophila_2:1640518_at:532:159; Interrogation_Position=257; Antisense; ACAACATGGCGTATGAGTGTCAAGA
>probe:Drosophila_2:1640518_at:585:389; Interrogation_Position=285; Antisense; GAAACTGACAACTGACAACATCGCG
>probe:Drosophila_2:1640518_at:590:397; Interrogation_Position=298; Antisense; GACAACATCGCGTCATGTTCATGTA
>probe:Drosophila_2:1640518_at:390:267; Interrogation_Position=317; Antisense; CATGTATGAAGGAACAGGGCGACTT
>probe:Drosophila_2:1640518_at:689:149; Interrogation_Position=338; Antisense; ACTTGTGGGCGGGTCTCATCAAATC
>probe:Drosophila_2:1640518_at:56:237; Interrogation_Position=359; Antisense; AATCGGGCGACCACGGAAATATATT
>probe:Drosophila_2:1640518_at:381:287; Interrogation_Position=372; Antisense; CGGAAATATATTCACACATTCGTAG
>probe:Drosophila_2:1640518_at:425:393; Interrogation_Position=55; Antisense; GACAAACAAATGGACGGACGTGCGG
>probe:Drosophila_2:1640518_at:510:139; Interrogation_Position=80; Antisense; ACGGATGGCAATTGGCGGACAAGCC

Paste this into a BLAST search page for me
GTTGACAATGAAGCTGGCGACGCATGACGCATGCGCGCAGACTAATTGTCAGGCGAGGAACACTCCTTTACACATACTCCTTTACACATATCGCTGTTGGGTTGGAGGAGCGTATATAGCTGCAAACAACATGGCGTATGAGTGTCAAGAGAAACTGACAACTGACAACATCGCGGACAACATCGCGTCATGTTCATGTACATGTATGAAGGAACAGGGCGACTTACTTGTGGGCGGGTCTCATCAAATCAATCGGGCGACCACGGAAATATATTCGGAAATATATTCACACATTCGTAGGACAAACAAATGGACGGACGTGCGGACGGATGGCAATTGGCGGACAAGCC

Full Affymetrix probeset data:

Annotations for 1640518_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720