FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640520_at:

>probe:Drosophila_2:1640520_at:382:71; Interrogation_Position=163; Antisense; AGGCATCCGGAATCCTCAAGGGCTA
>probe:Drosophila_2:1640520_at:506:653; Interrogation_Position=178; Antisense; TCAAGGGCTACGATGCGCTGCTCAA
>probe:Drosophila_2:1640520_at:192:447; Interrogation_Position=189; Antisense; GATGCGCTGCTCAATCTGGTGCTGG
>probe:Drosophila_2:1640520_at:518:429; Interrogation_Position=225; Antisense; GAGTATCTGCGCGACTCGGATGAGC
>probe:Drosophila_2:1640520_at:344:547; Interrogation_Position=242; Antisense; GGATGAGCCCTACAAACTGACCGAG
>probe:Drosophila_2:1640520_at:176:179; Interrogation_Position=255; Antisense; AAACTGACCGAGGAGCAGACCCGCA
>probe:Drosophila_2:1640520_at:642:503; Interrogation_Position=315; Antisense; GTCCTCATTTGTCCGCAAGACGGAG
>probe:Drosophila_2:1640520_at:444:425; Interrogation_Position=342; Antisense; GAGAGCATCGCCAATCCGTTTATAA
>probe:Drosophila_2:1640520_at:510:529; Interrogation_Position=392; Antisense; GGGATGCGTTCCAGAATGTAGACTA
>probe:Drosophila_2:1640520_at:287:239; Interrogation_Position=495; Antisense; AATCAGGCCGCAAAGTACCACGTTT
>probe:Drosophila_2:1640520_at:270:487; Interrogation_Position=509; Antisense; GTACCACGTTTATGAGCCCGCGAAA
>probe:Drosophila_2:1640520_at:241:293; Interrogation_Position=524; Antisense; GCCCGCGAAATTGTTTAAGCTTCTC
>probe:Drosophila_2:1640520_at:272:711; Interrogation_Position=578; Antisense; TTAATGCACTTTATCCTCTTCAGGT
>probe:Drosophila_2:1640520_at:470:275; Interrogation_Position=618; Antisense; CTACGGGTTTGCTTACGGTCAGATT

Paste this into a BLAST search page for me
AGGCATCCGGAATCCTCAAGGGCTATCAAGGGCTACGATGCGCTGCTCAAGATGCGCTGCTCAATCTGGTGCTGGGAGTATCTGCGCGACTCGGATGAGCGGATGAGCCCTACAAACTGACCGAGAAACTGACCGAGGAGCAGACCCGCAGTCCTCATTTGTCCGCAAGACGGAGGAGAGCATCGCCAATCCGTTTATAAGGGATGCGTTCCAGAATGTAGACTAAATCAGGCCGCAAAGTACCACGTTTGTACCACGTTTATGAGCCCGCGAAAGCCCGCGAAATTGTTTAAGCTTCTCTTAATGCACTTTATCCTCTTCAGGTCTACGGGTTTGCTTACGGTCAGATT

Full Affymetrix probeset data:

Annotations for 1640520_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720