FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640521_at:

>probe:Drosophila_2:1640521_at:314:49; Interrogation_Position=1004; Antisense; ATGCCAAGGAGTCCGATGTCATCCG
>probe:Drosophila_2:1640521_at:500:599; Interrogation_Position=1036; Antisense; TGTCTCTACACGGATCGCAGTGATC
>probe:Drosophila_2:1640521_at:555:449; Interrogation_Position=1057; Antisense; GATCCGCCAGCGAACTACAAATATT
>probe:Drosophila_2:1640521_at:327:665; Interrogation_Position=1072; Antisense; TACAAATATTTCGTCGCCGGTTGGG
>probe:Drosophila_2:1640521_at:590:369; Interrogation_Position=1104; Antisense; GAATGTGACCAATCGTGCCGTATCA
>probe:Drosophila_2:1640521_at:609:683; Interrogation_Position=1124; Antisense; TATCAAAGATCCTGCTGCGGGCGGC
>probe:Drosophila_2:1640521_at:396:505; Interrogation_Position=1159; Antisense; GTGCCGGCCGACGAGTGCAATGCAT
>probe:Drosophila_2:1640521_at:510:231; Interrogation_Position=1177; Antisense; AATGCATCCTTTGCGGAACAGCCGA
>probe:Drosophila_2:1640521_at:681:519; Interrogation_Position=1295; Antisense; GTGGACCTCTCATCCTGGAGATTGA
>probe:Drosophila_2:1640521_at:635:449; Interrogation_Position=1341; Antisense; GATCGTAGGCGTAATCTCCTCGGGC
>probe:Drosophila_2:1640521_at:638:23; Interrogation_Position=1424; Antisense; ATATCGAGGGTATCGTGTGGCCGTC
>probe:Drosophila_2:1640521_at:616:501; Interrogation_Position=1446; Antisense; GTCGAATCGTTTCTGAGGCGTCATT
>probe:Drosophila_2:1640521_at:218:473; Interrogation_Position=934; Antisense; GTTCAAATTCATCCGGACTATTCCG
>probe:Drosophila_2:1640521_at:561:489; Interrogation_Position=969; Antisense; GTACTACGATATCGCCATTCTGCAG

Paste this into a BLAST search page for me
ATGCCAAGGAGTCCGATGTCATCCGTGTCTCTACACGGATCGCAGTGATCGATCCGCCAGCGAACTACAAATATTTACAAATATTTCGTCGCCGGTTGGGGAATGTGACCAATCGTGCCGTATCATATCAAAGATCCTGCTGCGGGCGGCGTGCCGGCCGACGAGTGCAATGCATAATGCATCCTTTGCGGAACAGCCGAGTGGACCTCTCATCCTGGAGATTGAGATCGTAGGCGTAATCTCCTCGGGCATATCGAGGGTATCGTGTGGCCGTCGTCGAATCGTTTCTGAGGCGTCATTGTTCAAATTCATCCGGACTATTCCGGTACTACGATATCGCCATTCTGCAG

Full Affymetrix probeset data:

Annotations for 1640521_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720