FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640524_at:

>probe:Drosophila_2:1640524_at:432:587; Interrogation_Position=2086; Antisense; TGGAGAGCAACATCACCCACTTGGT
>probe:Drosophila_2:1640524_at:378:117; Interrogation_Position=2132; Antisense; AGCTTCGTATCTGTTCACATACACC
>probe:Drosophila_2:1640524_at:340:83; Interrogation_Position=2176; Antisense; AGGGCATCACGATAGAACAGCCTGA
>probe:Drosophila_2:1640524_at:523:385; Interrogation_Position=2190; Antisense; GAACAGCCTGATACCGAGGAGCGGT
>probe:Drosophila_2:1640524_at:92:77; Interrogation_Position=2233; Antisense; AGGAGTTCCAGCATCGGGTTACCAA
>probe:Drosophila_2:1640524_at:418:539; Interrogation_Position=2249; Antisense; GGTTACCAACTACCAGCAGTTTTTG
>probe:Drosophila_2:1640524_at:149:729; Interrogation_Position=2271; Antisense; TTGGGCCACATTGGCAACTGCCTAA
>probe:Drosophila_2:1640524_at:134:195; Interrogation_Position=2286; Antisense; AACTGCCTAATGTACTTGCTCTACG
>probe:Drosophila_2:1640524_at:303:61; Interrogation_Position=2295; Antisense; ATGTACTTGCTCTACGATGTGCCCA
>probe:Drosophila_2:1640524_at:18:553; Interrogation_Position=2350; Antisense; GGAGAAGGCTAACCATCGGCACTAT
>probe:Drosophila_2:1640524_at:709:305; Interrogation_Position=2362; Antisense; CCATCGGCACTATTTCGGTTTTAGC
>probe:Drosophila_2:1640524_at:512:539; Interrogation_Position=2378; Antisense; GGTTTTAGCCGTATCTAGATTCGAT
>probe:Drosophila_2:1640524_at:424:235; Interrogation_Position=2504; Antisense; AATCCTCTTGGTTTTGTCTATATAT
>probe:Drosophila_2:1640524_at:334:619; Interrogation_Position=2562; Antisense; TGCATTTACATAACGATACGCTCAA

Paste this into a BLAST search page for me
TGGAGAGCAACATCACCCACTTGGTAGCTTCGTATCTGTTCACATACACCAGGGCATCACGATAGAACAGCCTGAGAACAGCCTGATACCGAGGAGCGGTAGGAGTTCCAGCATCGGGTTACCAAGGTTACCAACTACCAGCAGTTTTTGTTGGGCCACATTGGCAACTGCCTAAAACTGCCTAATGTACTTGCTCTACGATGTACTTGCTCTACGATGTGCCCAGGAGAAGGCTAACCATCGGCACTATCCATCGGCACTATTTCGGTTTTAGCGGTTTTAGCCGTATCTAGATTCGATAATCCTCTTGGTTTTGTCTATATATTGCATTTACATAACGATACGCTCAA

Full Affymetrix probeset data:

Annotations for 1640524_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720