FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640526_at:

>probe:Drosophila_2:1640526_at:342:39; Interrogation_Position=1014; Antisense; ATCTCAGTGGCTCAAGTACTTGTGC
>probe:Drosophila_2:1640526_at:577:487; Interrogation_Position=1029; Antisense; GTACTTGTGCCTTACTTAATGCCTT
>probe:Drosophila_2:1640526_at:656:709; Interrogation_Position=1044; Antisense; TTAATGCCTTTACCTTGCCAACAAC
>probe:Drosophila_2:1640526_at:408:81; Interrogation_Position=1070; Antisense; AGGGCCGTCTATATACTCATTTCAG
>probe:Drosophila_2:1640526_at:202:207; Interrogation_Position=1117; Antisense; AAGCGTACAATGACTTCGCCTGACT
>probe:Drosophila_2:1640526_at:651:321; Interrogation_Position=1191; Antisense; GCCCACACCTATCCATATTTATATA
>probe:Drosophila_2:1640526_at:455:661; Interrogation_Position=1265; Antisense; TAACGTGTATTTACTGCCATCGGCA
>probe:Drosophila_2:1640526_at:70:229; Interrogation_Position=770; Antisense; AATGGACTGGCTTATCTTGGTTACA
>probe:Drosophila_2:1640526_at:41:729; Interrogation_Position=786; Antisense; TTGGTTACAGCTTTTACCTGGTCGT
>probe:Drosophila_2:1640526_at:173:131; Interrogation_Position=818; Antisense; ACCGTCGTTGTGCTGCTGAATATCG
>probe:Drosophila_2:1640526_at:294:615; Interrogation_Position=834; Antisense; TGAATATCGCCATCCTGTTGTACGC
>probe:Drosophila_2:1640526_at:373:213; Interrogation_Position=917; Antisense; AAGACCGCCATAATGCTGTACTAAG
>probe:Drosophila_2:1640526_at:221:381; Interrogation_Position=965; Antisense; GAACCTCTACGAAGTTGCTTGGCAA
>probe:Drosophila_2:1640526_at:412:113; Interrogation_Position=997; Antisense; AGCAGCGACACCTAGTAATCTCAGT

Paste this into a BLAST search page for me
ATCTCAGTGGCTCAAGTACTTGTGCGTACTTGTGCCTTACTTAATGCCTTTTAATGCCTTTACCTTGCCAACAACAGGGCCGTCTATATACTCATTTCAGAAGCGTACAATGACTTCGCCTGACTGCCCACACCTATCCATATTTATATATAACGTGTATTTACTGCCATCGGCAAATGGACTGGCTTATCTTGGTTACATTGGTTACAGCTTTTACCTGGTCGTACCGTCGTTGTGCTGCTGAATATCGTGAATATCGCCATCCTGTTGTACGCAAGACCGCCATAATGCTGTACTAAGGAACCTCTACGAAGTTGCTTGGCAAAGCAGCGACACCTAGTAATCTCAGT

Full Affymetrix probeset data:

Annotations for 1640526_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720